ID: 937099756

View in Genome Browser
Species Human (GRCh38)
Location 2:119259722-119259744
Sequence TGAGGTCTTTGCATCTCCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937099756_937099762 -4 Left 937099756 2:119259722-119259744 CCGAGGGAGATGCAAAGACCTCA No data
Right 937099762 2:119259741-119259763 CTCACTGGGGCTACTAAGGCTGG No data
937099756_937099764 10 Left 937099756 2:119259722-119259744 CCGAGGGAGATGCAAAGACCTCA No data
Right 937099764 2:119259755-119259777 TAAGGCTGGCTTTCCAGGCCTGG No data
937099756_937099763 5 Left 937099756 2:119259722-119259744 CCGAGGGAGATGCAAAGACCTCA No data
Right 937099763 2:119259750-119259772 GCTACTAAGGCTGGCTTTCCAGG No data
937099756_937099760 -8 Left 937099756 2:119259722-119259744 CCGAGGGAGATGCAAAGACCTCA No data
Right 937099760 2:119259737-119259759 AGACCTCACTGGGGCTACTAAGG No data
937099756_937099766 15 Left 937099756 2:119259722-119259744 CCGAGGGAGATGCAAAGACCTCA No data
Right 937099766 2:119259760-119259782 CTGGCTTTCCAGGCCTGGATGGG No data
937099756_937099765 14 Left 937099756 2:119259722-119259744 CCGAGGGAGATGCAAAGACCTCA No data
Right 937099765 2:119259759-119259781 GCTGGCTTTCCAGGCCTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937099756 Original CRISPR TGAGGTCTTTGCATCTCCCT CGG (reversed) Intronic