ID: 937099761

View in Genome Browser
Species Human (GRCh38)
Location 2:119259740-119259762
Sequence CAGCCTTAGTAGCCCCAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937099761_937099769 19 Left 937099761 2:119259740-119259762 CCTCACTGGGGCTACTAAGGCTG No data
Right 937099769 2:119259782-119259804 GCTCCCATTGCTGCACCTCCTGG No data
937099761_937099766 -3 Left 937099761 2:119259740-119259762 CCTCACTGGGGCTACTAAGGCTG No data
Right 937099766 2:119259760-119259782 CTGGCTTTCCAGGCCTGGATGGG No data
937099761_937099765 -4 Left 937099761 2:119259740-119259762 CCTCACTGGGGCTACTAAGGCTG No data
Right 937099765 2:119259759-119259781 GCTGGCTTTCCAGGCCTGGATGG No data
937099761_937099764 -8 Left 937099761 2:119259740-119259762 CCTCACTGGGGCTACTAAGGCTG No data
Right 937099764 2:119259755-119259777 TAAGGCTGGCTTTCCAGGCCTGG No data
937099761_937099770 20 Left 937099761 2:119259740-119259762 CCTCACTGGGGCTACTAAGGCTG No data
Right 937099770 2:119259783-119259805 CTCCCATTGCTGCACCTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937099761 Original CRISPR CAGCCTTAGTAGCCCCAGTG AGG (reversed) Intronic