ID: 937099764

View in Genome Browser
Species Human (GRCh38)
Location 2:119259755-119259777
Sequence TAAGGCTGGCTTTCCAGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937099761_937099764 -8 Left 937099761 2:119259740-119259762 CCTCACTGGGGCTACTAAGGCTG No data
Right 937099764 2:119259755-119259777 TAAGGCTGGCTTTCCAGGCCTGG No data
937099755_937099764 11 Left 937099755 2:119259721-119259743 CCCGAGGGAGATGCAAAGACCTC No data
Right 937099764 2:119259755-119259777 TAAGGCTGGCTTTCCAGGCCTGG No data
937099756_937099764 10 Left 937099756 2:119259722-119259744 CCGAGGGAGATGCAAAGACCTCA No data
Right 937099764 2:119259755-119259777 TAAGGCTGGCTTTCCAGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937099764 Original CRISPR TAAGGCTGGCTTTCCAGGCC TGG Intronic