ID: 937099765

View in Genome Browser
Species Human (GRCh38)
Location 2:119259759-119259781
Sequence GCTGGCTTTCCAGGCCTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937099756_937099765 14 Left 937099756 2:119259722-119259744 CCGAGGGAGATGCAAAGACCTCA No data
Right 937099765 2:119259759-119259781 GCTGGCTTTCCAGGCCTGGATGG No data
937099755_937099765 15 Left 937099755 2:119259721-119259743 CCCGAGGGAGATGCAAAGACCTC No data
Right 937099765 2:119259759-119259781 GCTGGCTTTCCAGGCCTGGATGG No data
937099761_937099765 -4 Left 937099761 2:119259740-119259762 CCTCACTGGGGCTACTAAGGCTG No data
Right 937099765 2:119259759-119259781 GCTGGCTTTCCAGGCCTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937099765 Original CRISPR GCTGGCTTTCCAGGCCTGGA TGG Intronic