ID: 937099769

View in Genome Browser
Species Human (GRCh38)
Location 2:119259782-119259804
Sequence GCTCCCATTGCTGCACCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937099761_937099769 19 Left 937099761 2:119259740-119259762 CCTCACTGGGGCTACTAAGGCTG No data
Right 937099769 2:119259782-119259804 GCTCCCATTGCTGCACCTCCTGG No data
937099767_937099769 -9 Left 937099767 2:119259768-119259790 CCAGGCCTGGATGGGCTCCCATT No data
Right 937099769 2:119259782-119259804 GCTCCCATTGCTGCACCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937099769 Original CRISPR GCTCCCATTGCTGCACCTCC TGG Intronic