ID: 937099770

View in Genome Browser
Species Human (GRCh38)
Location 2:119259783-119259805
Sequence CTCCCATTGCTGCACCTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937099761_937099770 20 Left 937099761 2:119259740-119259762 CCTCACTGGGGCTACTAAGGCTG No data
Right 937099770 2:119259783-119259805 CTCCCATTGCTGCACCTCCTGGG No data
937099767_937099770 -8 Left 937099767 2:119259768-119259790 CCAGGCCTGGATGGGCTCCCATT No data
Right 937099770 2:119259783-119259805 CTCCCATTGCTGCACCTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937099770 Original CRISPR CTCCCATTGCTGCACCTCCT GGG Intronic