ID: 937100001

View in Genome Browser
Species Human (GRCh38)
Location 2:119261312-119261334
Sequence AGTCCATGCAGACCACCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937099997_937100001 13 Left 937099997 2:119261276-119261298 CCAACAAGCTGGGCTAGAAGGGA No data
Right 937100001 2:119261312-119261334 AGTCCATGCAGACCACCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937100001 Original CRISPR AGTCCATGCAGACCACCCAG AGG Intronic
No off target data available for this crispr