ID: 937102808

View in Genome Browser
Species Human (GRCh38)
Location 2:119284495-119284517
Sequence GGTGATCCACTGAGGCCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937102808_937102813 0 Left 937102808 2:119284495-119284517 CCAAGAGGCCTCAGTGGATCACC No data
Right 937102813 2:119284518-119284540 GGGCTTGCATAATTTTTATCTGG No data
937102808_937102814 1 Left 937102808 2:119284495-119284517 CCAAGAGGCCTCAGTGGATCACC No data
Right 937102814 2:119284519-119284541 GGCTTGCATAATTTTTATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937102808 Original CRISPR GGTGATCCACTGAGGCCTCT TGG (reversed) Intergenic
No off target data available for this crispr