ID: 937109948

View in Genome Browser
Species Human (GRCh38)
Location 2:119357686-119357708
Sequence TTGAATAAGAATGGTGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937109948_937109952 21 Left 937109948 2:119357686-119357708 CCATTCTCACCATTCTTATTCAA No data
Right 937109952 2:119357730-119357752 CAGTGAAACAATGCAAGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937109948 Original CRISPR TTGAATAAGAATGGTGAGAA TGG (reversed) Intronic
No off target data available for this crispr