ID: 937111566

View in Genome Browser
Species Human (GRCh38)
Location 2:119370745-119370767
Sequence CCCGTGAAGTCCAACATCCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 77}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937111566_937111571 -9 Left 937111566 2:119370745-119370767 CCCGGGATGTTGGACTTCACGGG 0: 1
1: 0
2: 0
3: 8
4: 77
Right 937111571 2:119370759-119370781 CTTCACGGGCAAGGCCAAGTGGG 0: 1
1: 0
2: 2
3: 6
4: 120
937111566_937111574 13 Left 937111566 2:119370745-119370767 CCCGGGATGTTGGACTTCACGGG 0: 1
1: 0
2: 0
3: 8
4: 77
Right 937111574 2:119370781-119370803 GATGCCTGGAATGAGCTGAAAGG 0: 2
1: 0
2: 3
3: 19
4: 178
937111566_937111572 -1 Left 937111566 2:119370745-119370767 CCCGGGATGTTGGACTTCACGGG 0: 1
1: 0
2: 0
3: 8
4: 77
Right 937111572 2:119370767-119370789 GCAAGGCCAAGTGGGATGCCTGG 0: 1
1: 1
2: 0
3: 21
4: 230
937111566_937111570 -10 Left 937111566 2:119370745-119370767 CCCGGGATGTTGGACTTCACGGG 0: 1
1: 0
2: 0
3: 8
4: 77
Right 937111570 2:119370758-119370780 ACTTCACGGGCAAGGCCAAGTGG 0: 1
1: 0
2: 1
3: 10
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937111566 Original CRISPR CCCGTGAAGTCCAACATCCC GGG (reversed) Exonic
902942988 1:19813916-19813938 CCCGTGGACTCCAAGCTCCCAGG + Intergenic
904541444 1:31236498-31236520 CTGGTGAATTCCAACATCCCGGG + Intronic
906995373 1:50788053-50788075 ACCCTGAAGTCCAGCATCCGAGG + Exonic
907514721 1:54986343-54986365 TCCGTCAAGGCCAGCATCCCAGG + Exonic
909811543 1:79937489-79937511 CCAGTGTAGTTCAACATCACAGG - Intergenic
914325866 1:146615741-146615763 TCCCTAAAGTCTAACATCCCTGG + Intergenic
916259674 1:162828893-162828915 GCTGAGAAGTCCAACATCCAAGG - Intronic
916661277 1:166924278-166924300 CCCATGAATTCCAGTATCCCAGG + Intronic
919775955 1:201194159-201194181 CTCCGGAAGTCCCACATCCCTGG + Exonic
923998304 1:239521950-239521972 CCCTTGAATGCCAACATCCTTGG - Intronic
1075353209 10:121744940-121744962 GCCATGAAGTCCAACGTTCCAGG - Intronic
1076063598 10:127431206-127431228 GCCGTGGAGTCCCACCTCCCAGG + Intronic
1079960640 11:26919093-26919115 CCAGTGAAGTCCCACATGACTGG + Intergenic
1081931620 11:46875497-46875519 CTCGTGAGGTCCAACCTGCCAGG - Exonic
1086412178 11:86553803-86553825 CCTGGGAAGTCAAACATTCCTGG + Intronic
1088950484 11:114564650-114564672 CCCTTCAAGTCCCAGATCCCAGG - Intergenic
1089901241 11:121988049-121988071 CTTGTTTAGTCCAACATCCCCGG - Intergenic
1092901781 12:13066694-13066716 CCTGTGAAGTACAACATCGTTGG + Exonic
1094085533 12:26587464-26587486 ACAGGGAAGTCCAGCATCCCTGG + Intronic
1102031580 12:109743091-109743113 CCCCTGATGTCCATCTTCCCGGG - Intronic
1121952914 14:98187615-98187637 TTTGGGAAGTCCAACATCCCTGG + Intergenic
1122227895 14:100290430-100290452 CCTGTAAAGCCCAACTTCCCAGG + Intergenic
1125212461 15:37233216-37233238 CAGGAGAAGACCAACATCCCAGG + Intergenic
1132118320 15:99154573-99154595 CCTGGGAAGTCCAAGATCCAGGG - Intronic
1133190561 16:4130686-4130708 CCCTTGAAGTCCACCATCCTGGG - Intergenic
1135472266 16:22741879-22741901 CACCTGAGGTCCAACATTCCAGG - Intergenic
1136096905 16:27963342-27963364 TCCTAGAAGCCCAACATCCCAGG + Intronic
1136429328 16:30187669-30187691 CCAGGGAAGACCACCATCCCAGG + Intronic
1140007699 16:71095201-71095223 TCCCTAAAGTCTAACATCCCTGG - Intronic
1141159731 16:81621233-81621255 CCCCTGAAGTCCAGCCTCCCCGG - Intronic
1146933156 17:36792350-36792372 CCCATGAAATCCTGCATCCCAGG - Intergenic
1147980222 17:44269524-44269546 CCCGTGCAGTGCACCATGCCTGG + Intergenic
1149753881 17:59172245-59172267 CCGCTGAATTCCAACCTCCCTGG - Intronic
1163025008 19:14505779-14505801 CCCATGAAGGCAAACAACCCAGG + Intergenic
1165949755 19:39467652-39467674 CCCAGGAATTTCAACATCCCAGG + Intronic
1166732661 19:45067722-45067744 CCCCTGAAATCCACCCTCCCAGG - Intronic
935161059 2:100529897-100529919 CCCCTGAAGACCAAGATCCCGGG - Intergenic
937111566 2:119370745-119370767 CCCGTGAAGTCCAACATCCCGGG - Exonic
938226832 2:129623990-129624012 CACTTGAAGTCCCACATTCCAGG - Intergenic
941433416 2:165438463-165438485 ACTGTGAAGTCCAACATCAAAGG + Intergenic
945068491 2:205967496-205967518 CCTGTGAGGTTCCACATCCCTGG - Intergenic
945868222 2:215200472-215200494 CCTGAGAAGTCCATCCTCCCTGG + Intergenic
948055674 2:235007910-235007932 CCCTTGACGTCCAACCTCTCCGG - Intronic
1177058454 21:16339348-16339370 CCCCTGAATTCCAGCATCACTGG - Intergenic
1177680862 21:24368635-24368657 GCTGAGAAGTCCAAGATCCCAGG + Intergenic
1178495878 21:33085830-33085852 CCCTTGAGATCCAACATCCTGGG - Intergenic
1180996274 22:19967248-19967270 CCCGAGAAGTCCAGGAGCCCAGG + Intronic
1181969168 22:26677269-26677291 CCAGTGAAGTATAAGATCCCTGG - Intergenic
1183996259 22:41635079-41635101 CCCGTGGATTCCAAAATCCGAGG + Intronic
954414990 3:50388951-50388973 CCCGAGAGTTCCAGCATCCCAGG + Intronic
961964421 3:130887780-130887802 CTCGTGAAGTCCCCAATCCCAGG - Intronic
966266319 3:178048818-178048840 CCTCTGAAGTCCAACTTCCCGGG - Intergenic
979472592 4:121118206-121118228 GCCGTGCAGTCCAACATCACTGG + Intergenic
981227459 4:142313539-142313561 CCCATGAAGTGCAGCAGCCCAGG + Intronic
986705114 5:10448132-10448154 GCTCTGAAGACCAACATCCCGGG - Intronic
987594558 5:19980528-19980550 TCCTTGAAGTCCATCTTCCCAGG + Intronic
994274724 5:97822158-97822180 CCCCTGAAGCCCAAGATCCGTGG + Intergenic
998551385 5:143081035-143081057 CCAGTGAAGGCCAAAAACCCAGG - Intronic
1000309558 5:160029172-160029194 CAAGTGAAATCCAACAACCCAGG - Intronic
1000625019 5:163528799-163528821 CCCGAGAAGTCTAATCTCCCAGG - Intergenic
1002566420 5:180114690-180114712 CCCGTGAAGTCCCAAGGCCCCGG - Intronic
1002939190 6:1700955-1700977 ACAGTGAAGTGCAAAATCCCAGG + Intronic
1005115167 6:22328086-22328108 CCCATGAAGAACAATATCCCTGG - Intergenic
1006489073 6:34370684-34370706 CCAGTGAAGTCCAGCACCTCTGG + Intronic
1006791795 6:36706277-36706299 CACTCGAAGTCCCACATCCCAGG - Intronic
1007339924 6:41184919-41184941 CCAGTCAAGTCCATCATCCTGGG - Intergenic
1008038506 6:46772717-46772739 CCCCTCAAGTCCAAGATTCCTGG - Intergenic
1010735275 6:79437014-79437036 CCTTTGAAATCCAACATCCCAGG + Intergenic
1017717346 6:157222218-157222240 CCCTGAAAGTCCCACATCCCTGG + Intergenic
1019702119 7:2479023-2479045 CCCGTGAAGGTCAAAACCCCTGG - Intergenic
1025716716 7:63963787-63963809 CCCATGAAGTCCACCATCAGAGG - Intergenic
1030251548 7:107450895-107450917 CCCATGAGGTTCAACATCCAGGG + Intronic
1033191287 7:139283044-139283066 CCAGAAAACTCCAACATCCCTGG + Exonic
1036661793 8:10713994-10714016 CCCGTCCAGTCCAACACCCAGGG + Intergenic
1037461621 8:19116082-19116104 TTCGTGAAGTCCAAAACCCCTGG + Intergenic
1041165407 8:55087455-55087477 CCCGAGAATTCCAACATCCAGGG - Intergenic
1041389081 8:57333055-57333077 CAGGGGAAGTCCAACATCCTGGG + Intergenic
1047105480 8:121726561-121726583 GCTGGGAAGTCCAAGATCCCAGG + Intergenic
1048370685 8:133773769-133773791 CCCTGGGAGTCCATCATCCCAGG - Intergenic
1051392366 9:16579755-16579777 CCCATGAAATCCAACATCTTAGG + Intronic
1058608592 9:106750630-106750652 TCTGTTAAGTCCTACATCCCAGG + Intergenic
1061065532 9:128275612-128275634 CCCCCGAAGTCCGACCTCCCTGG - Intronic
1188493007 X:30755876-30755898 CCAGTGAAGTCCATCCTCCTAGG + Intergenic
1190983417 X:55478895-55478917 CCCGTGAATACCAAGATCCTTGG - Intergenic
1190985282 X:55494288-55494310 CCCGTGAATACCAAGATCCTTGG + Intergenic
1192330685 X:70173083-70173105 CCCTGGAAGTCCAGCATCCTGGG + Intergenic