ID: 937112904

View in Genome Browser
Species Human (GRCh38)
Location 2:119380396-119380418
Sequence AAGAGAAAATAGAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937112898_937112904 23 Left 937112898 2:119380350-119380372 CCTATATGGTTGGGTTCCAAAAG No data
Right 937112904 2:119380396-119380418 AAGAGAAAATAGAAGGAGGAAGG No data
937112900_937112904 7 Left 937112900 2:119380366-119380388 CCAAAAGCTCATTAGTGGCTTTG No data
Right 937112904 2:119380396-119380418 AAGAGAAAATAGAAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937112904 Original CRISPR AAGAGAAAATAGAAGGAGGA AGG Intergenic
No off target data available for this crispr