ID: 937113711

View in Genome Browser
Species Human (GRCh38)
Location 2:119387953-119387975
Sequence CACCATTTCTAGATGACTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937113711_937113715 13 Left 937113711 2:119387953-119387975 CCATGAGTCATCTAGAAATGGTG No data
Right 937113715 2:119387989-119388011 GCAGATGACACCATTTCCAGTGG No data
937113711_937113718 26 Left 937113711 2:119387953-119387975 CCATGAGTCATCTAGAAATGGTG No data
Right 937113718 2:119388002-119388024 TTTCCAGTGGAGACAGTCACGGG No data
937113711_937113717 25 Left 937113711 2:119387953-119387975 CCATGAGTCATCTAGAAATGGTG No data
Right 937113717 2:119388001-119388023 ATTTCCAGTGGAGACAGTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937113711 Original CRISPR CACCATTTCTAGATGACTCA TGG (reversed) Intergenic
No off target data available for this crispr