ID: 937113715

View in Genome Browser
Species Human (GRCh38)
Location 2:119387989-119388011
Sequence GCAGATGACACCATTTCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937113711_937113715 13 Left 937113711 2:119387953-119387975 CCATGAGTCATCTAGAAATGGTG No data
Right 937113715 2:119387989-119388011 GCAGATGACACCATTTCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937113715 Original CRISPR GCAGATGACACCATTTCCAG TGG Intergenic
No off target data available for this crispr