ID: 937113717

View in Genome Browser
Species Human (GRCh38)
Location 2:119388001-119388023
Sequence ATTTCCAGTGGAGACAGTCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937113711_937113717 25 Left 937113711 2:119387953-119387975 CCATGAGTCATCTAGAAATGGTG No data
Right 937113717 2:119388001-119388023 ATTTCCAGTGGAGACAGTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937113717 Original CRISPR ATTTCCAGTGGAGACAGTCA CGG Intergenic
No off target data available for this crispr