ID: 937113718

View in Genome Browser
Species Human (GRCh38)
Location 2:119388002-119388024
Sequence TTTCCAGTGGAGACAGTCAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937113711_937113718 26 Left 937113711 2:119387953-119387975 CCATGAGTCATCTAGAAATGGTG No data
Right 937113718 2:119388002-119388024 TTTCCAGTGGAGACAGTCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937113718 Original CRISPR TTTCCAGTGGAGACAGTCAC GGG Intergenic
No off target data available for this crispr