ID: 937116239

View in Genome Browser
Species Human (GRCh38)
Location 2:119406953-119406975
Sequence TGATGGGGGAGCCCTATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937116239_937116245 -8 Left 937116239 2:119406953-119406975 CCTGCCATAGGGCTCCCCCATCA No data
Right 937116245 2:119406968-119406990 CCCCATCACTGGGTAAACTGAGG No data
937116239_937116248 -3 Left 937116239 2:119406953-119406975 CCTGCCATAGGGCTCCCCCATCA No data
Right 937116248 2:119406973-119406995 TCACTGGGTAAACTGAGGCTTGG No data
937116239_937116250 27 Left 937116239 2:119406953-119406975 CCTGCCATAGGGCTCCCCCATCA No data
Right 937116250 2:119407003-119407025 TCTTTCTAATTTAAAATCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937116239 Original CRISPR TGATGGGGGAGCCCTATGGC AGG (reversed) Intergenic