ID: 937116240

View in Genome Browser
Species Human (GRCh38)
Location 2:119406957-119406979
Sequence CCAGTGATGGGGGAGCCCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937116240_937116250 23 Left 937116240 2:119406957-119406979 CCATAGGGCTCCCCCATCACTGG No data
Right 937116250 2:119407003-119407025 TCTTTCTAATTTAAAATCGCAGG No data
937116240_937116251 29 Left 937116240 2:119406957-119406979 CCATAGGGCTCCCCCATCACTGG No data
Right 937116251 2:119407009-119407031 TAATTTAAAATCGCAGGACCAGG No data
937116240_937116248 -7 Left 937116240 2:119406957-119406979 CCATAGGGCTCCCCCATCACTGG No data
Right 937116248 2:119406973-119406995 TCACTGGGTAAACTGAGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937116240 Original CRISPR CCAGTGATGGGGGAGCCCTA TGG (reversed) Intergenic