ID: 937116243 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:119406967-119406989 |
Sequence | CTCAGTTTACCCAGTGATGG GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
937116243_937116250 | 13 | Left | 937116243 | 2:119406967-119406989 | CCCCCATCACTGGGTAAACTGAG | No data | ||
Right | 937116250 | 2:119407003-119407025 | TCTTTCTAATTTAAAATCGCAGG | No data | ||||
937116243_937116251 | 19 | Left | 937116243 | 2:119406967-119406989 | CCCCCATCACTGGGTAAACTGAG | No data | ||
Right | 937116251 | 2:119407009-119407031 | TAATTTAAAATCGCAGGACCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
937116243 | Original CRISPR | CTCAGTTTACCCAGTGATGG GGG (reversed) | Intergenic | ||