ID: 937116244

View in Genome Browser
Species Human (GRCh38)
Location 2:119406968-119406990
Sequence CCTCAGTTTACCCAGTGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937116244_937116251 18 Left 937116244 2:119406968-119406990 CCCCATCACTGGGTAAACTGAGG No data
Right 937116251 2:119407009-119407031 TAATTTAAAATCGCAGGACCAGG No data
937116244_937116250 12 Left 937116244 2:119406968-119406990 CCCCATCACTGGGTAAACTGAGG No data
Right 937116250 2:119407003-119407025 TCTTTCTAATTTAAAATCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937116244 Original CRISPR CCTCAGTTTACCCAGTGATG GGG (reversed) Intergenic