ID: 937116246

View in Genome Browser
Species Human (GRCh38)
Location 2:119406969-119406991
Sequence GCCTCAGTTTACCCAGTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937116246_937116250 11 Left 937116246 2:119406969-119406991 CCCATCACTGGGTAAACTGAGGC No data
Right 937116250 2:119407003-119407025 TCTTTCTAATTTAAAATCGCAGG No data
937116246_937116251 17 Left 937116246 2:119406969-119406991 CCCATCACTGGGTAAACTGAGGC No data
Right 937116251 2:119407009-119407031 TAATTTAAAATCGCAGGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937116246 Original CRISPR GCCTCAGTTTACCCAGTGAT GGG (reversed) Intergenic