ID: 937116247

View in Genome Browser
Species Human (GRCh38)
Location 2:119406970-119406992
Sequence AGCCTCAGTTTACCCAGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937116247_937116252 30 Left 937116247 2:119406970-119406992 CCATCACTGGGTAAACTGAGGCT No data
Right 937116252 2:119407023-119407045 AGGACCAGGACCTGCACCACTGG No data
937116247_937116251 16 Left 937116247 2:119406970-119406992 CCATCACTGGGTAAACTGAGGCT No data
Right 937116251 2:119407009-119407031 TAATTTAAAATCGCAGGACCAGG No data
937116247_937116250 10 Left 937116247 2:119406970-119406992 CCATCACTGGGTAAACTGAGGCT No data
Right 937116250 2:119407003-119407025 TCTTTCTAATTTAAAATCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937116247 Original CRISPR AGCCTCAGTTTACCCAGTGA TGG (reversed) Intergenic