ID: 937116248

View in Genome Browser
Species Human (GRCh38)
Location 2:119406973-119406995
Sequence TCACTGGGTAAACTGAGGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937116240_937116248 -7 Left 937116240 2:119406957-119406979 CCATAGGGCTCCCCCATCACTGG No data
Right 937116248 2:119406973-119406995 TCACTGGGTAAACTGAGGCTTGG No data
937116237_937116248 8 Left 937116237 2:119406942-119406964 CCAGGTGTGCTCCTGCCATAGGG No data
Right 937116248 2:119406973-119406995 TCACTGGGTAAACTGAGGCTTGG No data
937116239_937116248 -3 Left 937116239 2:119406953-119406975 CCTGCCATAGGGCTCCCCCATCA No data
Right 937116248 2:119406973-119406995 TCACTGGGTAAACTGAGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937116248 Original CRISPR TCACTGGGTAAACTGAGGCT TGG Intergenic