ID: 937116249

View in Genome Browser
Species Human (GRCh38)
Location 2:119406996-119407018
Sequence TTTTAAATTAGAAAGACATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937116249_937116251 -10 Left 937116249 2:119406996-119407018 CCTGATGTCTTTCTAATTTAAAA No data
Right 937116251 2:119407009-119407031 TAATTTAAAATCGCAGGACCAGG No data
937116249_937116252 4 Left 937116249 2:119406996-119407018 CCTGATGTCTTTCTAATTTAAAA No data
Right 937116252 2:119407023-119407045 AGGACCAGGACCTGCACCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937116249 Original CRISPR TTTTAAATTAGAAAGACATC AGG (reversed) Intergenic