ID: 937116250

View in Genome Browser
Species Human (GRCh38)
Location 2:119407003-119407025
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937116239_937116250 27 Left 937116239 2:119406953-119406975 CCTGCCATAGGGCTCCCCCATCA No data
Right 937116250 2:119407003-119407025 TCTTTCTAATTTAAAATCGCAGG No data
937116240_937116250 23 Left 937116240 2:119406957-119406979 CCATAGGGCTCCCCCATCACTGG No data
Right 937116250 2:119407003-119407025 TCTTTCTAATTTAAAATCGCAGG No data
937116246_937116250 11 Left 937116246 2:119406969-119406991 CCCATCACTGGGTAAACTGAGGC No data
Right 937116250 2:119407003-119407025 TCTTTCTAATTTAAAATCGCAGG No data
937116244_937116250 12 Left 937116244 2:119406968-119406990 CCCCATCACTGGGTAAACTGAGG No data
Right 937116250 2:119407003-119407025 TCTTTCTAATTTAAAATCGCAGG No data
937116247_937116250 10 Left 937116247 2:119406970-119406992 CCATCACTGGGTAAACTGAGGCT No data
Right 937116250 2:119407003-119407025 TCTTTCTAATTTAAAATCGCAGG No data
937116243_937116250 13 Left 937116243 2:119406967-119406989 CCCCCATCACTGGGTAAACTGAG No data
Right 937116250 2:119407003-119407025 TCTTTCTAATTTAAAATCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type