ID: 937116251

View in Genome Browser
Species Human (GRCh38)
Location 2:119407009-119407031
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937116246_937116251 17 Left 937116246 2:119406969-119406991 CCCATCACTGGGTAAACTGAGGC No data
Right 937116251 2:119407009-119407031 TAATTTAAAATCGCAGGACCAGG No data
937116244_937116251 18 Left 937116244 2:119406968-119406990 CCCCATCACTGGGTAAACTGAGG No data
Right 937116251 2:119407009-119407031 TAATTTAAAATCGCAGGACCAGG No data
937116243_937116251 19 Left 937116243 2:119406967-119406989 CCCCCATCACTGGGTAAACTGAG No data
Right 937116251 2:119407009-119407031 TAATTTAAAATCGCAGGACCAGG No data
937116247_937116251 16 Left 937116247 2:119406970-119406992 CCATCACTGGGTAAACTGAGGCT No data
Right 937116251 2:119407009-119407031 TAATTTAAAATCGCAGGACCAGG No data
937116249_937116251 -10 Left 937116249 2:119406996-119407018 CCTGATGTCTTTCTAATTTAAAA No data
Right 937116251 2:119407009-119407031 TAATTTAAAATCGCAGGACCAGG No data
937116240_937116251 29 Left 937116240 2:119406957-119406979 CCATAGGGCTCCCCCATCACTGG No data
Right 937116251 2:119407009-119407031 TAATTTAAAATCGCAGGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type