ID: 937116252

View in Genome Browser
Species Human (GRCh38)
Location 2:119407023-119407045
Sequence AGGACCAGGACCTGCACCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937116249_937116252 4 Left 937116249 2:119406996-119407018 CCTGATGTCTTTCTAATTTAAAA No data
Right 937116252 2:119407023-119407045 AGGACCAGGACCTGCACCACTGG No data
937116247_937116252 30 Left 937116247 2:119406970-119406992 CCATCACTGGGTAAACTGAGGCT No data
Right 937116252 2:119407023-119407045 AGGACCAGGACCTGCACCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937116252 Original CRISPR AGGACCAGGACCTGCACCAC TGG Intergenic