ID: 937119020

View in Genome Browser
Species Human (GRCh38)
Location 2:119429367-119429389
Sequence GGTCACATTCTCAGTCCTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 131}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937119015_937119020 16 Left 937119015 2:119429328-119429350 CCGAATGGATCAGGGAATAGAGA 0: 1
1: 0
2: 2
3: 22
4: 156
Right 937119020 2:119429367-119429389 GGTCACATTCTCAGTCCTACAGG 0: 1
1: 0
2: 0
3: 12
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937119020 Original CRISPR GGTCACATTCTCAGTCCTAC AGG Intergenic
900535354 1:3174342-3174364 GGTCACATTCTGAGGCCTGGGGG + Intronic
900741812 1:4334782-4334804 GGTCACATTCGGAGTCCTGCTGG + Intergenic
902220219 1:14959814-14959836 TGTCAGCTTCTCAGTCCTGCGGG - Intronic
902704089 1:18192490-18192512 GCTCACATTGTCATCCCTACTGG + Intronic
902974343 1:20078165-20078187 GGTCACCTCCTCAGTCCTTCAGG - Intronic
904702554 1:32366532-32366554 GGGAACATTCTCAGTCTTCCAGG + Exonic
905075532 1:35268005-35268027 GATTACAGTCTCAGTCCTCCAGG - Intergenic
907528133 1:55066013-55066035 GGTCTCAGTCTCATTCCTAGTGG - Intergenic
909286439 1:73826015-73826037 GGCCACATTGTAAGTCCTCCAGG + Intergenic
910015916 1:82523072-82523094 GGTCGCATCCTCAATCCTTCAGG - Intergenic
911063178 1:93764895-93764917 GGCCACATCCACAGTCCTAGGGG + Intronic
911298510 1:96146832-96146854 GGTTACATTCTTGGTCTTACAGG + Intergenic
911506008 1:98752476-98752498 GGTCAGATTCTCAGCTTTACAGG + Intronic
918220384 1:182431356-182431378 GGTTACATTCTTGGTCTTACAGG - Intergenic
920232780 1:204481554-204481576 GGTCACATTCTTAGTGTCACTGG + Intronic
924220023 1:241864907-241864929 GGTCTCTTTCTCTGTCCTCCAGG + Intronic
1065008792 10:21403400-21403422 GGTTACATTCTTGGTCTTACAGG - Intergenic
1065134931 10:22658686-22658708 GTTCACATTCTCATTCTTATGGG - Intronic
1066202673 10:33157298-33157320 TGACACATTTTCAGTCCCACTGG + Intergenic
1069604812 10:69732426-69732448 TGTCTCACTCTCAGTCCTCCTGG - Intergenic
1072278995 10:93848983-93849005 GGTAACACTCTCAGGCATACAGG + Intergenic
1072295387 10:94004508-94004530 GGTCAGTTTCTGAGTCCCACAGG - Intronic
1073496718 10:103898345-103898367 GCACACATTCTCATTCCTCCTGG + Intronic
1077362526 11:2147039-2147061 GGTGACAGTCTCAGGCCTCCTGG - Intronic
1079325695 11:19489532-19489554 GGTCACAGTCTCTGACTTACAGG + Intronic
1079572673 11:21964161-21964183 GGTTACATTCTTGGTCTTACAGG + Intergenic
1082030862 11:47602436-47602458 GGTCACATTCTGATTCTGACTGG + Intergenic
1084418403 11:69048074-69048096 GGTGTCATTCTCACTCCTAGAGG - Intergenic
1085102757 11:73815438-73815460 GGTTACATTCTCAAACCTCCAGG - Intronic
1087377699 11:97365878-97365900 GGTCATATGCTGAGTCTTACCGG - Intergenic
1088232939 11:107691533-107691555 CTTCACATTCACAATCCTACAGG - Intergenic
1091260728 11:134232085-134232107 GGTTTCCTTCTCAGTCCAACAGG - Intronic
1091407673 12:219463-219485 GGGCTCAATCTCAGTCTTACCGG - Intergenic
1091674850 12:2481722-2481744 TGTCACATACTCAGTCCTATTGG + Intronic
1094017676 12:25882320-25882342 GGTTACATTCTTGGTCTTACAGG - Intergenic
1096243862 12:49973720-49973742 GGTCAAAGTCTCAGTCCTCTGGG - Intronic
1096865700 12:54561453-54561475 GGTCAGTTGCTCAGTTCTACTGG + Intronic
1096871635 12:54596189-54596211 GGCCACATTCTCAGCTCTTCGGG + Intergenic
1098591528 12:72219555-72219577 GGTCACATGCTCAGCCCTGGGGG + Intronic
1101848729 12:108385409-108385431 GGTCAAATTCTCCTTCCCACTGG + Intergenic
1102809212 12:115809465-115809487 GGTCACATTCTGAGGTCTAGGGG + Intergenic
1102855924 12:116293393-116293415 GGTCACCTACGCAGGCCTACTGG - Intergenic
1105418540 13:20232794-20232816 GGACACATCCTCAGTCTTTCTGG + Intergenic
1106588822 13:31080644-31080666 GGTCACATTCTAGGTGCTAGGGG - Intergenic
1113896233 13:113766208-113766230 GGTCACATTCTCCGTCCTGGTGG - Exonic
1114401592 14:22415544-22415566 GGACACATTTTCACTCCTAATGG + Intergenic
1119050206 14:71359634-71359656 TGACAGATTCTCAGTCCTACTGG + Intronic
1132222393 15:100114730-100114752 GGTCACATTCCCAATCCAAGTGG + Intronic
1132633937 16:933725-933747 GGTCACATCCACCGTCCTCCCGG + Intronic
1134171598 16:11974009-11974031 GGTTACCTTCTCAGTTTTACAGG + Intronic
1137654979 16:50152552-50152574 GCTCACACTCTCAGTCTTAGTGG + Intergenic
1138687234 16:58736017-58736039 GGCCACATTCTAGGTCCTTCCGG + Intergenic
1142268917 16:89079052-89079074 GGTCACATTCCCAGACCCCCAGG - Intergenic
1142538076 17:634073-634095 AGTCACATTCTCAGGACTACTGG + Intronic
1148627180 17:49078535-49078557 GGTTACATTCTTGGTCTTACAGG + Intergenic
1156396391 18:36703816-36703838 GGTCACATTCTCCATCTGACGGG + Intronic
1157591230 18:48837397-48837419 GTTCAAATTCTCAGTGCTGCAGG + Intronic
1158320046 18:56252367-56252389 GGTCACATTCTGAGGTCTTCGGG + Intergenic
1161306046 19:3568861-3568883 GGTCACATTCTGAGGCCTTGGGG - Intronic
1162201547 19:9024297-9024319 GGTCACATTCTGAGAGGTACTGG - Intergenic
1166552975 19:43679057-43679079 GGTCACATTCTGAGTACTGGGGG - Intergenic
1168182383 19:54671217-54671239 TGTCACTTTCTCAGCCCTGCAGG + Intronic
927901263 2:26820526-26820548 GGTCACATTCACAGTACTGAGGG + Intergenic
933001375 2:76928040-76928062 GGGCACATTCTCTGCCTTACAGG - Intronic
934602399 2:95667660-95667682 GGGGACATTCTCAGTCTGACTGG - Intergenic
935614799 2:105066783-105066805 GGCCTCGTTCTCAGTCATACAGG - Intronic
937119020 2:119429367-119429389 GGTCACATTCTCAGTCCTACAGG + Intergenic
937675495 2:124585530-124585552 GGTTACATTCTTGGTCTTACAGG + Intronic
938766101 2:134461431-134461453 GGGCACAGCTTCAGTCCTACAGG - Intronic
939894993 2:147780722-147780744 CCTCATATTCTTAGTCCTACTGG + Intergenic
940233373 2:151483063-151483085 GGTCACATTCTGAGGCCTTGGGG + Intronic
940785026 2:157971887-157971909 GGGCAAGTTCTCAGTCCTGCTGG - Intronic
940860266 2:158763988-158764010 TGTCAGGGTCTCAGTCCTACTGG - Intergenic
942034616 2:171999028-171999050 GGTTACATTCTCAGTTTGACTGG + Intronic
943260541 2:185655191-185655213 TGTCTCATTCTCAGTCTTAAGGG - Intergenic
948545988 2:238729257-238729279 GGTGACACCCTCTGTCCTACTGG - Intergenic
1170874481 20:20237342-20237364 GGTCGCATCCTCATTCCTACAGG + Intronic
1173819431 20:46011050-46011072 GGTGAGATTCTGAGTCCTCCTGG + Exonic
1178700057 21:34825713-34825735 GGTCACATTCACAGTTCTGGGGG - Intronic
1179508646 21:41858166-41858188 GGTCACATCCTCAGTGAAACTGG - Intronic
1184836265 22:47023476-47023498 ATTCACATTCTCAATTCTACAGG - Intronic
951779286 3:26345587-26345609 GGTCACTTCAGCAGTCCTACAGG + Intergenic
951889634 3:27556223-27556245 GGTAACATTCTTGGTCTTACTGG - Intergenic
953979648 3:47407233-47407255 GGACACCCCCTCAGTCCTACCGG - Intronic
955617351 3:60823343-60823365 GGTCACATTCTAAGTACTGAGGG - Intronic
959019940 3:101177843-101177865 GGTCACATCCTGAGTACTAGGGG + Intergenic
961369169 3:126419069-126419091 GGTCTCCTTCTCAGCCCTAGGGG - Exonic
962419203 3:135213487-135213509 GGTCACCTTCTCATTATTACTGG + Intronic
964320178 3:155487512-155487534 GGTCGCCTTTTCAGTCCTATAGG + Intronic
964381679 3:156103922-156103944 GGTAACATCCTGAGTCCTTCTGG + Intronic
964815198 3:160710106-160710128 GGTCACATTCACAGTACTGGAGG + Intergenic
965754581 3:172012611-172012633 GGTCAAAGGCTCAGTCCCACAGG - Intergenic
968441960 4:628743-628765 GCTCACACTCTCGGGCCTACAGG + Intronic
970784727 4:19782561-19782583 GGTCACATTCACAGTACTAGGGG + Intergenic
972113445 4:35595442-35595464 GGTCACATTCAAAGTCATCCTGG - Intergenic
973742677 4:53933495-53933517 GCTCACATTCAAAGTCCTCCTGG - Intronic
974294605 4:59980843-59980865 GGTTACATTCTTGGTTCTACAGG - Intergenic
975907025 4:79225657-79225679 GGTCACATTTTCTGGCCTAGAGG + Intergenic
978413658 4:108453269-108453291 GGACAATTTCTTAGTCCTACAGG - Intergenic
981150415 4:141374097-141374119 GATCACATGCTCAGTCATAAAGG - Intergenic
982082603 4:151805463-151805485 GGTCACATTCTGAGGCATAGGGG - Intergenic
983342907 4:166488516-166488538 GGTCCCACACTCAGTCTTACTGG - Intergenic
986861005 5:11926747-11926769 GGTTACATTCTTGGTCTTACAGG - Intergenic
988500838 5:31782471-31782493 GGTCCCAGTCTCAGTCATGCAGG + Intronic
990586610 5:57217683-57217705 GGTCATATTCTTAATCATACTGG - Intronic
990805835 5:59660639-59660661 GGTGATATTCTCAGTCCCAGGGG - Intronic
991471083 5:66969755-66969777 GGTGACTTTCCCAGTCTTACAGG - Intronic
992407712 5:76475571-76475593 GGCCACATTCCCGGTCTTACAGG - Intronic
1005449439 6:25958630-25958652 GGTTACATTCTTGGTCTTACAGG - Intergenic
1005533293 6:26730092-26730114 CATCACTTTCTGAGTCCTACAGG + Intergenic
1005535353 6:26749689-26749711 CATCACTTTCTGAGTCCTACAGG - Intergenic
1005537501 6:26771572-26771594 CATCACTTTCTGAGTCCTACAGG - Intergenic
1006119463 6:31795356-31795378 GGTCAGACCCTCAGTCCTATGGG - Intronic
1009006388 6:57793322-57793344 CATCACTTTCTGAGTCCTACAGG - Intergenic
1009008376 6:57813982-57814004 CATCACTTTCTGAGTCCTACAGG - Intergenic
1009297114 6:61965338-61965360 GGTCTCCTTCCCAGTCCTAGCGG - Intronic
1010339505 6:74731877-74731899 GATCACATTCACAGTACCACGGG - Intergenic
1011782691 6:90808064-90808086 GGTCAAATTCCCACTCCAACTGG + Intergenic
1013206283 6:107948781-107948803 GGTTACCTTCTTGGTCCTACAGG - Intronic
1013825324 6:114204157-114204179 GGTTACATTCTTGGTCTTACAGG + Intronic
1014014268 6:116511821-116511843 GGTCATATTCTCAGTGCTGCAGG - Exonic
1019001395 6:168756078-168756100 GATAAAATTCTCAGTACTACAGG + Intergenic
1023810640 7:43908598-43908620 GGTTACATTCTTGGTCTTACAGG - Intronic
1024362071 7:48478690-48478712 GGTTACATTCTTGGTCTTACAGG + Intronic
1026831764 7:73614671-73614693 GGTCACATTCTCATTCATTTGGG - Intronic
1027437698 7:78182401-78182423 GGTCACATTCACATACCCACAGG - Intronic
1033057704 7:138074898-138074920 GGTTACATTCTTAGTCTTACAGG + Intronic
1035260771 7:157660202-157660224 GGTCACATTCTCGGACCCTCTGG - Intronic
1035408252 7:158615436-158615458 GGTCACATTATGAGGACTACAGG + Intergenic
1037025642 8:14033291-14033313 GGTCACCTTCACAGTCTTCCAGG + Intergenic
1047361849 8:124176265-124176287 GGTCACATTCTGAGTCCTGAAGG - Intergenic
1047606144 8:126476644-126476666 TGTCACATTCTCAGACTTAAAGG + Intergenic
1050324451 9:4486341-4486363 GGTTACATTCTTGGTCTTACAGG - Intergenic
1051847291 9:21465680-21465702 GGTCACATGCTCTGTTCTCCTGG + Intergenic
1053536108 9:38927941-38927963 CATCACTTTCTCAGTCCAACAGG - Intergenic
1054630028 9:67436011-67436033 CATCACTTTCTCAGTCCAACAGG + Intergenic
1054878770 9:70123600-70123622 GGTCACATTCTAAGTCCTGGGGG - Intronic
1055599586 9:77901717-77901739 AGTTACAGTCTCAGTCCTTCTGG + Intronic
1057150859 9:92794624-92794646 GCTCACATACTCTCTCCTACAGG - Intergenic
1057218139 9:93240852-93240874 ATCCACTTTCTCAGTCCTACTGG + Intronic
1189227007 X:39421464-39421486 AATCAGTTTCTCAGTCCTACTGG - Intergenic
1193793140 X:85841073-85841095 GGGCACATCCTCAGACCTCCAGG - Intergenic
1199085762 X:143629274-143629296 GGTCCCATTCGAAGTCCTCCTGG - Exonic
1201934723 Y:19396179-19396201 GTTCAAGTTCTCAGTCCTGCTGG - Intergenic