ID: 937119359

View in Genome Browser
Species Human (GRCh38)
Location 2:119431408-119431430
Sequence CTCACTCTGCGGTGTGACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937119359_937119364 13 Left 937119359 2:119431408-119431430 CCAAGGTCACACCGCAGAGTGAG No data
Right 937119364 2:119431444-119431466 CTGCGCCTGCCTCCTCCCTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937119359 Original CRISPR CTCACTCTGCGGTGTGACCT TGG (reversed) Intronic
No off target data available for this crispr