ID: 937119362

View in Genome Browser
Species Human (GRCh38)
Location 2:119431419-119431441
Sequence GCTCTGCTGCCCTCACTCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937119362_937119364 2 Left 937119362 2:119431419-119431441 CCGCAGAGTGAGGGCAGCAGAGC No data
Right 937119364 2:119431444-119431466 CTGCGCCTGCCTCCTCCCTTCGG No data
937119362_937119370 23 Left 937119362 2:119431419-119431441 CCGCAGAGTGAGGGCAGCAGAGC No data
Right 937119370 2:119431465-119431487 GGACCCTGCCGCGTTCCCAGAGG No data
937119362_937119373 27 Left 937119362 2:119431419-119431441 CCGCAGAGTGAGGGCAGCAGAGC No data
Right 937119373 2:119431469-119431491 CCTGCCGCGTTCCCAGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937119362 Original CRISPR GCTCTGCTGCCCTCACTCTG CGG (reversed) Intronic
No off target data available for this crispr