ID: 937119364

View in Genome Browser
Species Human (GRCh38)
Location 2:119431444-119431466
Sequence CTGCGCCTGCCTCCTCCCTT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937119359_937119364 13 Left 937119359 2:119431408-119431430 CCAAGGTCACACCGCAGAGTGAG No data
Right 937119364 2:119431444-119431466 CTGCGCCTGCCTCCTCCCTTCGG No data
937119358_937119364 14 Left 937119358 2:119431407-119431429 CCCAAGGTCACACCGCAGAGTGA No data
Right 937119364 2:119431444-119431466 CTGCGCCTGCCTCCTCCCTTCGG No data
937119362_937119364 2 Left 937119362 2:119431419-119431441 CCGCAGAGTGAGGGCAGCAGAGC No data
Right 937119364 2:119431444-119431466 CTGCGCCTGCCTCCTCCCTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937119364 Original CRISPR CTGCGCCTGCCTCCTCCCTT CGG Intronic
No off target data available for this crispr