ID: 937119533

View in Genome Browser
Species Human (GRCh38)
Location 2:119432009-119432031
Sequence CCCACCGCGAGCGCCGGCGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 55}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937119523_937119533 18 Left 937119523 2:119431968-119431990 CCGTGGGAGGTTGGGGGTGGGAG 0: 1
1: 1
2: 11
3: 79
4: 743
Right 937119533 2:119432009-119432031 CCCACCGCGAGCGCCGGCGTCGG 0: 1
1: 0
2: 0
3: 5
4: 55
937119520_937119533 21 Left 937119520 2:119431965-119431987 CCGCCGTGGGAGGTTGGGGGTGG 0: 1
1: 0
2: 0
3: 28
4: 313
Right 937119533 2:119432009-119432031 CCCACCGCGAGCGCCGGCGTCGG 0: 1
1: 0
2: 0
3: 5
4: 55
937119518_937119533 23 Left 937119518 2:119431963-119431985 CCCCGCCGTGGGAGGTTGGGGGT 0: 1
1: 0
2: 1
3: 11
4: 153
Right 937119533 2:119432009-119432031 CCCACCGCGAGCGCCGGCGTCGG 0: 1
1: 0
2: 0
3: 5
4: 55
937119519_937119533 22 Left 937119519 2:119431964-119431986 CCCGCCGTGGGAGGTTGGGGGTG 0: 1
1: 0
2: 5
3: 46
4: 353
Right 937119533 2:119432009-119432031 CCCACCGCGAGCGCCGGCGTCGG 0: 1
1: 0
2: 0
3: 5
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937119533 Original CRISPR CCCACCGCGAGCGCCGGCGT CGG Intronic
900115407 1:1025879-1025901 CCCACCAGGAGCCCCGGGGTTGG - Intronic
922730545 1:227946921-227946943 CCTACCCCGAGCGCCGCCGCTGG - Intronic
1073088694 10:100913342-100913364 TCCTCCGCGAGCTCAGGCGTTGG + Intronic
1073112538 10:101071179-101071201 CCCACCCCGAGAGCTGGAGTAGG + Intergenic
1081616596 11:44594968-44594990 CCCACCGCCAGCCCAGGCTTTGG - Intronic
1087233795 11:95696171-95696193 AGCACCGCGAGAGCCAGCGTGGG + Intergenic
1091718410 12:2795534-2795556 CGCCCCGCGCGCGCCGGGGTGGG - Intronic
1103415135 12:120738307-120738329 CCCAACGTGAGCCCAGGCGTTGG - Exonic
1112271902 13:97976480-97976502 CCCGCCGCGGCCGCCGGCGCCGG - Intronic
1114031266 14:18583152-18583174 CCCCCTGCCAGCGCCGGCGCAGG + Intergenic
1114083661 14:19221253-19221275 CCCACCACGAGGGCAGGCGATGG + Intergenic
1121850779 14:97219509-97219531 CCAACCGCGAGCGCTCGCCTGGG - Intergenic
1122865915 14:104603923-104603945 CCCACCTCGAGCTCAGGCCTTGG - Intronic
1132552799 16:560315-560337 CCCGCCGCGAGCGCGGTCGGAGG + Intergenic
1140065949 16:71611232-71611254 CCCACCTAGAGCGCCTGCGTAGG + Intergenic
1142216625 16:88833179-88833201 CCAACCCCGAGCGGCAGCGTGGG + Intronic
1142749193 17:1977524-1977546 CCCACCCCGCCCGCCGGCCTGGG + Intronic
1143750070 17:9021513-9021535 CCCAGCGCGAGTGGCGGCGGCGG + Intergenic
1151933504 17:77247622-77247644 CCCACCCCGACCCCCGGCGGTGG - Intergenic
1152627361 17:81393776-81393798 CCCGAAGCGGGCGCCGGCGTAGG + Intergenic
1159102291 18:63970400-63970422 CCCACCGCGAGACCCGGCGAAGG + Intronic
1160556510 18:79729094-79729116 CCCAGCACGAGCGCTGGCGCGGG - Intronic
1160992100 19:1864114-1864136 CCGGCCGCGCGCCCCGGCGTGGG - Intergenic
1161560234 19:4969093-4969115 CCCCCCGCGAGCGCTTGCGGAGG + Intronic
1165329077 19:35131472-35131494 CCCACCGTGAATGCCAGCGTGGG - Exonic
1166223185 19:41378472-41378494 CCCTCCGTGAGCGCTGGCCTGGG + Exonic
1167797487 19:51719372-51719394 CCCACCGCGCCCGCCGCCGCGGG + Exonic
1168343826 19:55641100-55641122 CCCCTGGCGAGCGCCGGCGGCGG - Intronic
1168348229 19:55661103-55661125 CCGACCACGGGCACCGGCGTTGG - Exonic
927997234 2:27494877-27494899 CCAACCGCGAGGACCGGCGGAGG - Exonic
937119533 2:119432009-119432031 CCCACCGCGAGCGCCGGCGTCGG + Intronic
938492921 2:131775380-131775402 CCCACCACGAGGGCAGGCGATGG - Intergenic
940830347 2:158458063-158458085 CACACCGCGAGCGCGGGCAGTGG + Intronic
942046634 2:172102779-172102801 CCCAGCGCGAGCGCGGGCTCTGG + Exonic
949058946 2:241945472-241945494 CCCACCGCGGGCTCCGGCTGGGG - Intergenic
1175278246 20:57786478-57786500 CCCACCGCAAGCACCGGCTGGGG + Intergenic
1180294314 22:10872014-10872036 CCCACCACGAGGGCAGGCGATGG - Intergenic
1180455379 22:15510210-15510232 CCCCCTGCCAGCGCCGGCGCAGG + Intergenic
1180497120 22:15901428-15901450 CCCACCACGAGGGCAGGCGATGG - Intergenic
1183201358 22:36387601-36387623 CCCTCCCCGAGCGCCCGCGTGGG + Intronic
952367140 3:32685143-32685165 CGCGCCTGGAGCGCCGGCGTGGG - Intronic
954025742 3:47781827-47781849 AACACCGCGAGGGCCGGGGTGGG - Exonic
955246199 3:57227592-57227614 TCTCCCGCGAGCGCGGGCGTCGG - Intergenic
956677938 3:71753429-71753451 CCCAGCGCGGGCGCCGCCGCCGG + Intronic
969330327 4:6470956-6470978 CGCAGCGCGAGCGCGGGCGCGGG - Intronic
971195759 4:24471031-24471053 CCCGCCGCGCTCGCCGGCGCTGG - Intergenic
980053898 4:128061886-128061908 CCCAGCACCAGCGCCGGCGACGG - Intronic
981315438 4:143336341-143336363 CCTGCCGCGAGCCCCGGGGTGGG + Intergenic
998491626 5:142551856-142551878 CCCACCCGGGGCGCCGGCGCTGG - Intergenic
1002645078 5:180649018-180649040 CCGACCGCGAGCGGAGGCGCTGG + Intronic
1011054843 6:83193655-83193677 CCCACAGTGAGCGCCGCCGGCGG + Intronic
1020013537 7:4818638-4818660 CCCACAGCGAGTGCCGGCAAAGG + Intronic
1021717315 7:23471301-23471323 GCCACCGCGAGCGCAGGCGGAGG - Intergenic
1023418271 7:39951276-39951298 GCCACCGCGAGCACCGGCGGCGG + Exonic
1023937232 7:44748746-44748768 CCCGCCCCGAGCGCCGGCTCGGG + Intronic
1034275990 7:149824079-149824101 CCCACAGTGAATGCCGGCGTGGG + Intergenic
1057643783 9:96854187-96854209 CCCGGCGCGAGCGGCGGCGGGGG - Exonic
1060770183 9:126326833-126326855 CTCACCGAGAGCGGCGGCGGCGG - Exonic
1060952325 9:127612204-127612226 GCCCCCGCGCGCGCCGGCGGCGG + Intergenic
1062567535 9:137169957-137169979 CCCACCGCGGGTGCCGGGGGCGG - Exonic
1199445089 X:147911988-147912010 CCGACGGCGAGCGCGGGCGGCGG + Intronic