ID: 937120010

View in Genome Browser
Species Human (GRCh38)
Location 2:119434557-119434579
Sequence GGCAGGGAAGCTGAGCAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937120010_937120022 17 Left 937120010 2:119434557-119434579 CCAGCCTGCTCAGCTTCCCTGCC No data
Right 937120022 2:119434597-119434619 GGAAGCCCCACCAGGAGCATGGG No data
937120010_937120015 -4 Left 937120010 2:119434557-119434579 CCAGCCTGCTCAGCTTCCCTGCC No data
Right 937120015 2:119434576-119434598 TGCCCACCCGGCTTCAGCACTGG No data
937120010_937120023 18 Left 937120010 2:119434557-119434579 CCAGCCTGCTCAGCTTCCCTGCC No data
Right 937120023 2:119434598-119434620 GAAGCCCCACCAGGAGCATGGGG No data
937120010_937120021 16 Left 937120010 2:119434557-119434579 CCAGCCTGCTCAGCTTCCCTGCC No data
Right 937120021 2:119434596-119434618 TGGAAGCCCCACCAGGAGCATGG No data
937120010_937120020 9 Left 937120010 2:119434557-119434579 CCAGCCTGCTCAGCTTCCCTGCC No data
Right 937120020 2:119434589-119434611 TCAGCACTGGAAGCCCCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937120010 Original CRISPR GGCAGGGAAGCTGAGCAGGC TGG (reversed) Intronic
No off target data available for this crispr