ID: 937120014

View in Genome Browser
Species Human (GRCh38)
Location 2:119434574-119434596
Sequence AGTGCTGAAGCCGGGTGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937120014_937120022 0 Left 937120014 2:119434574-119434596 CCTGCCCACCCGGCTTCAGCACT No data
Right 937120022 2:119434597-119434619 GGAAGCCCCACCAGGAGCATGGG No data
937120014_937120021 -1 Left 937120014 2:119434574-119434596 CCTGCCCACCCGGCTTCAGCACT No data
Right 937120021 2:119434596-119434618 TGGAAGCCCCACCAGGAGCATGG No data
937120014_937120020 -8 Left 937120014 2:119434574-119434596 CCTGCCCACCCGGCTTCAGCACT No data
Right 937120020 2:119434589-119434611 TCAGCACTGGAAGCCCCACCAGG No data
937120014_937120023 1 Left 937120014 2:119434574-119434596 CCTGCCCACCCGGCTTCAGCACT No data
Right 937120023 2:119434598-119434620 GAAGCCCCACCAGGAGCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937120014 Original CRISPR AGTGCTGAAGCCGGGTGGGC AGG (reversed) Intronic
No off target data available for this crispr