ID: 937120017

View in Genome Browser
Species Human (GRCh38)
Location 2:119434579-119434601
Sequence CTTCCAGTGCTGAAGCCGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937120017_937120021 -6 Left 937120017 2:119434579-119434601 CCACCCGGCTTCAGCACTGGAAG No data
Right 937120021 2:119434596-119434618 TGGAAGCCCCACCAGGAGCATGG No data
937120017_937120022 -5 Left 937120017 2:119434579-119434601 CCACCCGGCTTCAGCACTGGAAG No data
Right 937120022 2:119434597-119434619 GGAAGCCCCACCAGGAGCATGGG No data
937120017_937120023 -4 Left 937120017 2:119434579-119434601 CCACCCGGCTTCAGCACTGGAAG No data
Right 937120023 2:119434598-119434620 GAAGCCCCACCAGGAGCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937120017 Original CRISPR CTTCCAGTGCTGAAGCCGGG TGG (reversed) Intronic
No off target data available for this crispr