ID: 937120019

View in Genome Browser
Species Human (GRCh38)
Location 2:119434583-119434605
Sequence GGGGCTTCCAGTGCTGAAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937120019_937120022 -9 Left 937120019 2:119434583-119434605 CCGGCTTCAGCACTGGAAGCCCC No data
Right 937120022 2:119434597-119434619 GGAAGCCCCACCAGGAGCATGGG No data
937120019_937120021 -10 Left 937120019 2:119434583-119434605 CCGGCTTCAGCACTGGAAGCCCC No data
Right 937120021 2:119434596-119434618 TGGAAGCCCCACCAGGAGCATGG No data
937120019_937120023 -8 Left 937120019 2:119434583-119434605 CCGGCTTCAGCACTGGAAGCCCC No data
Right 937120023 2:119434598-119434620 GAAGCCCCACCAGGAGCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937120019 Original CRISPR GGGGCTTCCAGTGCTGAAGC CGG (reversed) Intronic
No off target data available for this crispr