ID: 937120021

View in Genome Browser
Species Human (GRCh38)
Location 2:119434596-119434618
Sequence TGGAAGCCCCACCAGGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937120013_937120021 0 Left 937120013 2:119434573-119434595 CCCTGCCCACCCGGCTTCAGCAC No data
Right 937120021 2:119434596-119434618 TGGAAGCCCCACCAGGAGCATGG No data
937120017_937120021 -6 Left 937120017 2:119434579-119434601 CCACCCGGCTTCAGCACTGGAAG No data
Right 937120021 2:119434596-119434618 TGGAAGCCCCACCAGGAGCATGG No data
937120011_937120021 12 Left 937120011 2:119434561-119434583 CCTGCTCAGCTTCCCTGCCCACC No data
Right 937120021 2:119434596-119434618 TGGAAGCCCCACCAGGAGCATGG No data
937120010_937120021 16 Left 937120010 2:119434557-119434579 CCAGCCTGCTCAGCTTCCCTGCC No data
Right 937120021 2:119434596-119434618 TGGAAGCCCCACCAGGAGCATGG No data
937120014_937120021 -1 Left 937120014 2:119434574-119434596 CCTGCCCACCCGGCTTCAGCACT No data
Right 937120021 2:119434596-119434618 TGGAAGCCCCACCAGGAGCATGG No data
937120016_937120021 -5 Left 937120016 2:119434578-119434600 CCCACCCGGCTTCAGCACTGGAA No data
Right 937120021 2:119434596-119434618 TGGAAGCCCCACCAGGAGCATGG No data
937120019_937120021 -10 Left 937120019 2:119434583-119434605 CCGGCTTCAGCACTGGAAGCCCC No data
Right 937120021 2:119434596-119434618 TGGAAGCCCCACCAGGAGCATGG No data
937120018_937120021 -9 Left 937120018 2:119434582-119434604 CCCGGCTTCAGCACTGGAAGCCC No data
Right 937120021 2:119434596-119434618 TGGAAGCCCCACCAGGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937120021 Original CRISPR TGGAAGCCCCACCAGGAGCA TGG Intronic
No off target data available for this crispr