ID: 937123826

View in Genome Browser
Species Human (GRCh38)
Location 2:119460251-119460273
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937123822_937123826 12 Left 937123822 2:119460216-119460238 CCTGGCAGGGACACTTCTTAAAG No data
Right 937123826 2:119460251-119460273 AACCAAAAGAAGCTAATGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr