ID: 937124586

View in Genome Browser
Species Human (GRCh38)
Location 2:119465372-119465394
Sequence CTGTAGGCATGGCTGGATCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937124586_937124593 8 Left 937124586 2:119465372-119465394 CCTAGATCCAGCCATGCCTACAG No data
Right 937124593 2:119465403-119465425 CATGAACTTGCCACTTACATGGG No data
937124586_937124594 13 Left 937124586 2:119465372-119465394 CCTAGATCCAGCCATGCCTACAG No data
Right 937124594 2:119465408-119465430 ACTTGCCACTTACATGGGTCAGG No data
937124586_937124592 7 Left 937124586 2:119465372-119465394 CCTAGATCCAGCCATGCCTACAG No data
Right 937124592 2:119465402-119465424 CCATGAACTTGCCACTTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937124586 Original CRISPR CTGTAGGCATGGCTGGATCT AGG (reversed) Intronic
No off target data available for this crispr