ID: 937126009

View in Genome Browser
Species Human (GRCh38)
Location 2:119475428-119475450
Sequence CAGCTCTGGGCACCTGGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937126009_937126016 -9 Left 937126009 2:119475428-119475450 CCCAGGCCAGGTGCCCAGAGCTG No data
Right 937126016 2:119475442-119475464 CCAGAGCTGCTAACAAGGCAGGG No data
937126009_937126014 -10 Left 937126009 2:119475428-119475450 CCCAGGCCAGGTGCCCAGAGCTG No data
Right 937126014 2:119475441-119475463 CCCAGAGCTGCTAACAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937126009 Original CRISPR CAGCTCTGGGCACCTGGCCT GGG (reversed) Intronic
No off target data available for this crispr