ID: 937126014

View in Genome Browser
Species Human (GRCh38)
Location 2:119475441-119475463
Sequence CCCAGAGCTGCTAACAAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937126009_937126014 -10 Left 937126009 2:119475428-119475450 CCCAGGCCAGGTGCCCAGAGCTG No data
Right 937126014 2:119475441-119475463 CCCAGAGCTGCTAACAAGGCAGG No data
937126005_937126014 13 Left 937126005 2:119475405-119475427 CCCAAGACAGATGCTGCATGTGA No data
Right 937126014 2:119475441-119475463 CCCAGAGCTGCTAACAAGGCAGG No data
937126006_937126014 12 Left 937126006 2:119475406-119475428 CCAAGACAGATGCTGCATGTGAC No data
Right 937126014 2:119475441-119475463 CCCAGAGCTGCTAACAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937126014 Original CRISPR CCCAGAGCTGCTAACAAGGC AGG Intronic
No off target data available for this crispr