ID: 937126105

View in Genome Browser
Species Human (GRCh38)
Location 2:119476056-119476078
Sequence CCTGTCAGGACCCATGTAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937126096_937126105 0 Left 937126096 2:119476033-119476055 CCAGTCACATGGACCCCACCCCT No data
Right 937126105 2:119476056-119476078 CCTGTCAGGACCCATGTAGTAGG No data
937126094_937126105 12 Left 937126094 2:119476021-119476043 CCTGCGGTTTCTCCAGTCACATG No data
Right 937126105 2:119476056-119476078 CCTGTCAGGACCCATGTAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937126105 Original CRISPR CCTGTCAGGACCCATGTAGT AGG Intronic
No off target data available for this crispr