ID: 937126660

View in Genome Browser
Species Human (GRCh38)
Location 2:119478922-119478944
Sequence TTGTCTGATGCTGCTTTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 755
Summary {0: 1, 1: 0, 2: 4, 3: 56, 4: 694}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937126660_937126668 -2 Left 937126660 2:119478922-119478944 CCAAGAAAAGCAGCATCAGACAA 0: 1
1: 0
2: 4
3: 56
4: 694
Right 937126668 2:119478943-119478965 AAGGATGGGGGATGGACCGAGGG 0: 1
1: 0
2: 3
3: 65
4: 570
937126660_937126666 -10 Left 937126660 2:119478922-119478944 CCAAGAAAAGCAGCATCAGACAA 0: 1
1: 0
2: 4
3: 56
4: 694
Right 937126666 2:119478935-119478957 CATCAGACAAGGATGGGGGATGG 0: 1
1: 1
2: 9
3: 31
4: 300
937126660_937126667 -3 Left 937126660 2:119478922-119478944 CCAAGAAAAGCAGCATCAGACAA 0: 1
1: 0
2: 4
3: 56
4: 694
Right 937126667 2:119478942-119478964 CAAGGATGGGGGATGGACCGAGG 0: 1
1: 0
2: 1
3: 9
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937126660 Original CRISPR TTGTCTGATGCTGCTTTTCT TGG (reversed) Intronic
900831665 1:4969908-4969930 TTTTCTGATGCTGCTACTCTAGG + Intergenic
902083933 1:13842426-13842448 TTGTCTTGTGCTGGTTTTCAAGG + Intergenic
902746676 1:18479252-18479274 TTCTCTGATGCTCCTCTTTTAGG - Intergenic
903276504 1:22225414-22225436 TTGTCTGGTGCAGCTTCTTTTGG - Intergenic
904852274 1:33468056-33468078 CTGTCTGCTGCTGCTTTTGGGGG + Intergenic
905571782 1:39011933-39011955 TTTTCTAATGCTCCATTTCTAGG + Intergenic
905954095 1:41977658-41977680 TTGTATGTTGCAGCTTTTCAAGG - Intronic
906578956 1:46918431-46918453 TTGTCTTGTGCTGGTTTTCAAGG + Intergenic
906594379 1:47062105-47062127 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
906689496 1:47783271-47783293 TTGTCTCTTTCTGTTTTTCTTGG - Intronic
906851582 1:49256697-49256719 AACTCTGTTGCTGCTTTTCTTGG - Intronic
906958840 1:50401820-50401842 TTGTCTTGTGCTGATTTTCAAGG - Intergenic
907950723 1:59180942-59180964 TTTTCTGTTTCTGCTTTCCTTGG - Intergenic
908252412 1:62275391-62275413 TGGTCTTGTACTGCTTTTCTGGG + Intronic
909051141 1:70769768-70769790 TTGTCTTGTGCTGGTTTTCAAGG + Intergenic
909467889 1:75994073-75994095 GTGTCTGATACTGCTTTCCAAGG + Intergenic
909485366 1:76167065-76167087 TTGTCTTGTGCTGGTTTTCAAGG + Intronic
909661240 1:78085004-78085026 TTGTCTTGTGCTGGTTTTCAAGG + Intronic
909711986 1:78661837-78661859 TTGTCTTATGCTGAATTTGTTGG - Intronic
909760006 1:79274424-79274446 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
910333399 1:86101453-86101475 TTGTCTTATGCTGGTTTTCAAGG + Intronic
911464696 1:98236959-98236981 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
911504378 1:98730333-98730355 TTGTCTTGTGCTGGTTTTCAAGG - Intronic
911778172 1:101841760-101841782 TTGTATTATCCTGATTTTCTGGG + Intronic
911794852 1:102062627-102062649 TTGTCTTATGCCGGTTTTCAAGG - Intergenic
912543873 1:110437116-110437138 TTGTCTGAAGCTGCCTTACAGGG - Intergenic
912594792 1:110863838-110863860 TTGTCTTGTGCTGGTTTTCAAGG + Intergenic
912710767 1:111948302-111948324 TTGTCTGTGGCTGCTTTTCCAGG - Intronic
912884865 1:113460346-113460368 TTGTCTCATGCCGGTTTTCAAGG - Intronic
912893626 1:113561688-113561710 TTGTCTTGTGCTGGTTTTCAAGG - Intronic
913395782 1:118370317-118370339 TTGTCTGATGCTGAAGTTTTGGG + Intergenic
913454296 1:119015345-119015367 TCTTCTGAGGCCGCTTTTCTTGG + Intergenic
913685437 1:121227462-121227484 TTGTACCATGCTGCTTCTCTTGG - Intronic
914037284 1:144015066-144015088 TTGTACCATGCTGCTTCTCTTGG - Intergenic
914152171 1:145052866-145052888 TTGTACCATGCTGCTTCTCTTGG + Intronic
914394278 1:147250361-147250383 TTGTCTGATGCTGCTCTGGCAGG + Intronic
914697640 1:150099915-150099937 TTGTCTTGTGCTGGTTTTCAAGG - Intronic
915076980 1:153316324-153316346 TTGTCTTGTGCTGGTTTTCAAGG + Intergenic
916182815 1:162102010-162102032 TTGTCTTGTGCTGGTTTTCAAGG + Intronic
916185696 1:162130549-162130571 TTGTCTGTTCCTCCTATTCTTGG - Intronic
917184767 1:172340869-172340891 TTGTCTTCTGCTGGTTTTCAGGG + Intronic
917294619 1:173505728-173505750 TTGTTTGATGCTGGCATTCTGGG - Intronic
917305657 1:173621731-173621753 TTGTCTTGTGCTGGTTTTCAAGG - Intronic
917622814 1:176814850-176814872 TTGTCTTGTGCTGGTTTTCAAGG + Intronic
918007634 1:180556970-180556992 TTAACTTATGCTGCTTTGCTGGG - Intergenic
918552901 1:185764418-185764440 TTATCTGATGCTATTTTTTTAGG + Intronic
918730928 1:187995321-187995343 TTGTCTGAGGCTTCTCTGCTTGG + Intergenic
919519367 1:198568142-198568164 TTGTCTTGTGCTGGTTTTCAAGG + Intergenic
919568109 1:199214659-199214681 TTGTCTTATGTTGGTTTTCAAGG + Intergenic
919578460 1:199340827-199340849 TTGTATTATGCTGGTTTTCAAGG - Intergenic
920184866 1:204153092-204153114 TTCTCTGAAGGCGCTTTTCTGGG - Intergenic
920472755 1:206246020-206246042 TTGTACCATGCTGCTTCTCTTGG - Intronic
921336357 1:214090896-214090918 TTGTCTTGTGCTGGTTTTCAAGG + Intergenic
921347217 1:214198785-214198807 TTGTCTGTTGCTGGCATTCTTGG - Intergenic
921564962 1:216705881-216705903 CTGTCTGATGCTGCCTGCCTGGG + Intronic
921881400 1:220258661-220258683 TTGTCTTGTGCTGGTTTTCAAGG - Intronic
922381572 1:225034128-225034150 TTGTCTTTTGCTGTTTTTCAAGG + Intronic
922971121 1:229739535-229739557 TTTTCTTATTCTCCTTTTCTTGG - Intergenic
924109018 1:240679416-240679438 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
924392313 1:243576310-243576332 TTGTCTTGTGCTGGTTTTCAAGG - Intronic
924479916 1:244420461-244420483 ATGTCTCATGCTGATTTTCCAGG + Intronic
1062883995 10:1002609-1002631 TTCTCTGTTTTTGCTTTTCTCGG + Intronic
1063632440 10:7746571-7746593 ATGTCTGATTCTGTTTTGCTAGG + Exonic
1063769398 10:9180798-9180820 TTTTCTGATGCTTCTTATCCAGG + Intergenic
1063911468 10:10834853-10834875 TTGTCCGATGCTGCCTCTCCAGG + Intergenic
1064250514 10:13703110-13703132 TTGTCTAATTCAGCTTTTCTGGG - Intronic
1065861377 10:29875247-29875269 GTTTCTGCTGCTGCTTTTATTGG + Intergenic
1066144106 10:32538550-32538572 TTGTCTTGTGCTGGTTTTCAAGG + Intronic
1066326651 10:34367094-34367116 TTGTCTGATGTTTCTTTGATTGG - Intronic
1066356974 10:34694426-34694448 TGTTCTGATGCTATTTTTCTTGG - Intronic
1066509591 10:36081954-36081976 TAGTCTGATGTTCCTTTTGTAGG + Intergenic
1066522897 10:36242637-36242659 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
1067923620 10:50484970-50484992 TTGTCTTGTGCTGGTTTTCAAGG - Intronic
1068276659 10:54808276-54808298 TTGTCTAAGGCTGCTTTTGGAGG - Intronic
1068687763 10:59887110-59887132 CTTTTTGATGCTGCCTTTCTTGG - Intronic
1068778542 10:60894261-60894283 TGGTCTGGTGCAGCTTTTCTTGG - Intronic
1069093579 10:64230458-64230480 TGGTTTGATCTTGCTTTTCTAGG - Intergenic
1069120422 10:64563213-64563235 TTGTCTTGTGCTGGTTTTCAAGG + Intergenic
1069234011 10:66047554-66047576 TTGTCTTGTGCTGGTTTTCAAGG - Intronic
1071035102 10:81235371-81235393 TTGTCTTCTGCTGGTTTTCAAGG + Intergenic
1071317036 10:84411875-84411897 TTGTCTTGTGCTGGTTTTCAAGG + Intronic
1071404689 10:85318627-85318649 TGGTCTACTGCTGCTTTGCTAGG - Intergenic
1072870865 10:99118624-99118646 TTGTCTTGTGCTGGTTTTCAAGG - Intronic
1073263027 10:102204734-102204756 TTCTCTTATGATGATTTTCTAGG + Intergenic
1073863570 10:107774659-107774681 TTGTCTCGTGCTGGTTTTCAAGG - Intergenic
1074068347 10:110039633-110039655 TTGTCTGAAGCTGCTTAGTTTGG - Intronic
1074229346 10:111517905-111517927 TTGTCTTGTGCTGCTTTTGGGGG + Intergenic
1074642189 10:115398771-115398793 TTGTCTTGTGCTGGTTTTCAAGG + Intronic
1075018545 10:118929275-118929297 TTCTCTGATGCTGCTTCAATAGG - Intergenic
1075289637 10:121217350-121217372 TTATCTGATGCTGCGTGGCTGGG + Intergenic
1075860447 10:125671199-125671221 TTGTCTTGTGCTGGTTTTCAAGG + Intronic
1075963706 10:126591621-126591643 TTGTCTTATGCTGGTTTTCAAGG - Intronic
1076074109 10:127519022-127519044 TTGTCTGGTTCTGGTTTTCAAGG - Intergenic
1076191434 10:128486126-128486148 TTTTCTGAATATGCTTTTCTGGG + Intergenic
1076933302 10:133549155-133549177 TTGTCTTATGCTGGTTTTTAAGG - Intronic
1077828488 11:5836650-5836672 TTGTCTTGTGCTGGTTTTCAAGG + Intronic
1078743038 11:14086212-14086234 TTGTCTTGTGCTGGTTTTCAAGG + Intronic
1079276637 11:19044067-19044089 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
1079738835 11:24032551-24032573 TTGTCTTGTGCTGGTTTTCAAGG + Intergenic
1079879270 11:25904103-25904125 TTGTCTTGTGCTGGTTTTCAAGG + Intergenic
1080273951 11:30482143-30482165 TTCTCTTATTCTGCTTTTCCTGG - Intronic
1080576005 11:33599753-33599775 GTGTGTGATGCTGGTTTACTGGG + Intronic
1081439896 11:43068579-43068601 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
1082179734 11:49102894-49102916 TTTTCTGATGCTGCATTAATTGG + Intergenic
1083586322 11:63862341-63862363 TTGTCAGAACCAGCTTTTCTTGG + Intronic
1084720391 11:70902019-70902041 TTGCCTGTTGCTGTTTTTCAGGG - Intronic
1085379607 11:76102635-76102657 TTGTCTCCTGCTGGTTTTCATGG + Intronic
1085856011 11:80176953-80176975 TTGTCTTGTGCTGGTTTTCAAGG + Intergenic
1086685548 11:89730018-89730040 TTTTCTGATGCTGCATTAATTGG - Intergenic
1086741607 11:90376525-90376547 TTGTCTTGTGCTGATTTTCAAGG + Intergenic
1086762398 11:90648842-90648864 TTGTCTAATGCTGGTTTTCAAGG - Intergenic
1086958770 11:92961013-92961035 ATGCTTGATGCTGATTTTCTTGG - Intergenic
1087346817 11:96982114-96982136 TTGTCTGATAAAGCTTTCCTTGG + Intergenic
1087627147 11:100608099-100608121 TTGTCTTGTGCTGATTTTCAAGG - Intergenic
1088155101 11:106792690-106792712 TTGTCTTCTGCTGCTTTTCAAGG - Intronic
1088472993 11:110206925-110206947 GAGTCTGATGCTGCTGTTTTGGG - Intronic
1089092516 11:115889793-115889815 TAGGCTGAGCCTGCTTTTCTTGG - Intergenic
1090740668 11:129657332-129657354 TTGTCTTATTCTGATTTTCAAGG - Intergenic
1090847151 11:130539561-130539583 TTGTCTTGTGCTGGTTTTCAAGG + Intergenic
1091705417 12:2690141-2690163 TTGCCTGCTGCTGCCTTTCCAGG - Intronic
1091850094 12:3689259-3689281 TTGTCTTGTGCTGGTTTTCAAGG + Intronic
1092952481 12:13519939-13519961 TTGTCTTGTGCTGGTTTTCAAGG + Intergenic
1092982379 12:13809476-13809498 ATGTCTGGTGCTGCTTATATAGG + Intronic
1093408258 12:18832965-18832987 TTGTCTTTTGCTGGTTTTCAAGG - Intergenic
1093539493 12:20264741-20264763 TTGGTAGTTGCTGCTTTTCTGGG + Intergenic
1093659083 12:21733642-21733664 TTGTCTTATGCTGGTTTTCAAGG + Intronic
1094790922 12:33914096-33914118 TTGTCTTGTGCTGGTTTTCAAGG + Intergenic
1095761399 12:45841508-45841530 TAGTTTAATGCTGCTTTTTTTGG + Intronic
1096034318 12:48451416-48451438 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
1098434731 12:70456536-70456558 TTGTCTTTTGCTGGTTTTTTAGG + Intergenic
1098458861 12:70709392-70709414 TTGTCTTGTGCTGATTTTCAAGG - Intronic
1098667650 12:73183810-73183832 TTGTCTGGTGCTGGGTTTCAAGG + Intergenic
1098830368 12:75354067-75354089 TTGTCTTATACTGGTTTTCAAGG - Intronic
1099152788 12:79135988-79136010 TTGTCTCAAGCTGCCCTTCTGGG - Intronic
1099249103 12:80230323-80230345 TTGTCTGAGGCTTATTTTCTTGG + Intronic
1099359460 12:81681781-81681803 TTGGCTGATCCTGCTCTTCAGGG - Intronic
1100135567 12:91549123-91549145 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
1100156749 12:91808540-91808562 TTGTCTTATGCTGGTTTTCAAGG - Intergenic
1100815353 12:98381617-98381639 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
1100900634 12:99236725-99236747 TTGTCTTGTGCTGATTTTCAAGG + Intronic
1101447244 12:104746005-104746027 TTGTCTTGTGCTGGTTTTCAAGG + Intronic
1101835114 12:108289563-108289585 TTGTAGGATGCTGCTTTTCCTGG - Exonic
1101908737 12:108847197-108847219 TTGTGTGATGTTCCTTGTCTAGG - Intronic
1102273451 12:111560575-111560597 ACGTCTGATGCTAGTTTTCTTGG - Intronic
1103408300 12:120691645-120691667 TTGTTTGCTGCTGCATCTCTTGG + Intronic
1104677602 12:130724333-130724355 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
1105584265 13:21729531-21729553 CTTTCTGAAGCTGTTTTTCTTGG + Intergenic
1105866368 13:24463721-24463743 TTGTCTTGTGCTGGTTTTCAAGG - Intronic
1106050053 13:26181179-26181201 TTCCCTGGTGCTGCTTTTCCTGG - Intronic
1106322143 13:28650838-28650860 TCGCCTAATGCTGCATTTCTCGG + Intergenic
1106934215 13:34700477-34700499 TTCTCTGTTGCTGCTTTCCTCGG + Intergenic
1107207842 13:37816946-37816968 TTGTCTTGTGCTGGTTTTCAAGG - Intronic
1107329889 13:39287902-39287924 TTGTCTCATGCTGGTTTTCAAGG - Intergenic
1107359576 13:39603543-39603565 TTGCCTGTTGGGGCTTTTCTGGG + Intergenic
1107395243 13:40008797-40008819 TTGTCTTGTGCTGGTTTTCAAGG + Intergenic
1108239766 13:48451200-48451222 TTGTCTTGTGCTGGTTTTCAAGG + Intronic
1108776000 13:53765854-53765876 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
1108818800 13:54321036-54321058 TTGACTCCTGCTGCTATTCTGGG - Intergenic
1109318325 13:60778505-60778527 TTGTCTTGTGCTGGTTTTCAAGG + Intergenic
1109666725 13:65549670-65549692 TTGTCTTGTGCTGGTTTTCAAGG + Intergenic
1109867161 13:68280375-68280397 TTGTTTTATGATGCTTTTGTAGG + Intergenic
1109927383 13:69161977-69161999 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
1110174518 13:72539758-72539780 TTGTCAGAAGCTGGTTATCTAGG + Intergenic
1111212717 13:85100664-85100686 TTGTCTGATGTAGCTTCTCCTGG - Intergenic
1111232109 13:85357092-85357114 TTGTCTTGTGCTGGTTTTCATGG - Intergenic
1111526092 13:89472789-89472811 TTGTCTTCTGCTGGTTTTCAAGG + Intergenic
1111925530 13:94459533-94459555 TTGTCTGCTGTTGATGTTCTAGG + Intronic
1112175942 13:97024225-97024247 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
1113917608 13:113883771-113883793 TTGTGTGGTGTTGCTTTTCGAGG + Intergenic
1114694242 14:24611977-24611999 TTGGCTGTTACTGCTTTTCTGGG + Intergenic
1116459334 14:45153898-45153920 TTGACATATGCTGTTTTTCTAGG + Exonic
1116614264 14:47113831-47113853 TTGTCTTGTGCTGATTTTCAAGG - Intronic
1116945624 14:50832018-50832040 TTGTCTGTTGCTTGCTTTCTCGG - Intergenic
1117079219 14:52134079-52134101 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
1117204068 14:53423247-53423269 TTATTTTATGGTGCTTTTCTTGG - Intergenic
1117665128 14:58048639-58048661 TTTTCTCATGCTATTTTTCTTGG - Intronic
1117851390 14:59974320-59974342 TTGACTGTGGCTGCTTTTCCAGG + Intronic
1118045074 14:61960766-61960788 TTGTCTTGTGCTGGTTTTCAAGG + Intergenic
1118558606 14:67054036-67054058 TTGTCTTGTGCTGATTTTCAAGG - Intronic
1118613435 14:67559061-67559083 TTGTCTGATGCTGGGATTATAGG + Intronic
1119235317 14:73014858-73014880 TTGTCTGCTGTTCATTTTCTTGG - Intronic
1119270272 14:73297622-73297644 TTATCTGACTCTGGTTTTCTTGG - Intronic
1119929562 14:78531818-78531840 TTATTTTATGCTTCTTTTCTAGG + Intronic
1120283488 14:82467929-82467951 TTGTCTTATACTGTTTTTCAAGG - Intergenic
1120799546 14:88673451-88673473 TTGTCTTGTGCTGGTTTTCAAGG - Intronic
1121289718 14:92764060-92764082 TTGTCACATGCTGTTCTTCTAGG - Intergenic
1121291474 14:92779440-92779462 TTGTCACATGCTGTTCTTCTAGG + Intergenic
1121498863 14:94417601-94417623 TTGTTCGATGCTGTTTCTCTTGG - Intergenic
1123476551 15:20595489-20595511 TTTCCAGATGCTGCTTTTCTGGG + Intergenic
1123641460 15:22404875-22404897 TTTCCAGATGCTGCTTTTCTGGG - Intergenic
1123917767 15:25049494-25049516 TTGTCTGTTTTTGCTTTTGTTGG + Intergenic
1124021044 15:25923601-25923623 TTGTCTTCTGCTGGTTTTCAAGG + Intergenic
1124078230 15:26466470-26466492 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
1124717541 15:32079226-32079248 TTGTCTTGTGCTGGTTTTCATGG - Intronic
1124874260 15:33576691-33576713 TTGTCTTGTGCTGGTTTTCAAGG - Intronic
1124923902 15:34052421-34052443 TTGTCTTGTGCTGGTTTTCATGG - Intronic
1125393141 15:39217237-39217259 TTATCTCATGCTGGTTTTCAAGG - Intergenic
1126927236 15:53603411-53603433 TTGTCTTGTGCTGATTTTCAAGG - Intronic
1126957174 15:53946300-53946322 TTGTCTTGTGCTGGTTTTCAAGG + Intergenic
1127202591 15:56672246-56672268 TTGTCTTGTGCTGGTTTTCAAGG + Intronic
1127318162 15:57817034-57817056 GTGTCTGATTCTGGTTTCCTTGG + Intergenic
1128548307 15:68581847-68581869 TTCTCTGCTGCTGCTTCTCCAGG + Intronic
1128751734 15:70154936-70154958 TTGTCTGATGTTTATATTCTGGG - Intergenic
1128820763 15:70650773-70650795 TTGTAATATCCTGCTTTTCTGGG - Intergenic
1130097236 15:80864938-80864960 TAGTGTGATGCTGCTGTTCAGGG + Intronic
1130657140 15:85799546-85799568 TTTTCTGATGCTGATGGTCTGGG - Intergenic
1130730077 15:86482822-86482844 TTGGCTGATGAAGCTTTTGTTGG - Intronic
1131314843 15:91326234-91326256 TTGTCTTATGCTGGTTTTCAAGG + Intergenic
1131725426 15:95218006-95218028 TTGTCTATTTTTGCTTTTCTTGG - Intergenic
1131923187 15:97352870-97352892 TTGTTTGTTTCTGCTTTTCTAGG + Intergenic
1132039049 15:98509561-98509583 TTTTCTGATTATGTTTTTCTTGG - Intronic
1132085694 15:98906692-98906714 ATGTCTTATGCTGCTTTTCCAGG + Intronic
1132753706 16:1471508-1471530 TTTCTTGGTGCTGCTTTTCTGGG - Intronic
1133882924 16:9799914-9799936 TTACCTGATGCTTATTTTCTGGG - Intronic
1134245216 16:12534678-12534700 ATCTTTGATTCTGCTTTTCTTGG + Intronic
1135906647 16:26518096-26518118 TAGTAAGAGGCTGCTTTTCTTGG + Intergenic
1136662445 16:31775732-31775754 TTGTCTTGTGCTGGTTTTCAAGG - Intronic
1140182339 16:72732759-72732781 TTGTCTTGTGCTGGTTTTCAAGG + Intergenic
1141035874 16:80625154-80625176 ATGTCTGATGCAGGTTTACTGGG + Intronic
1143242635 17:5456701-5456723 TTGCCTGATTATGCTTTTCATGG - Intronic
1143421183 17:6793821-6793843 TTATCTGATCTTCCTTTTCTTGG - Intronic
1144121166 17:12154521-12154543 TTGTCTTGTGCTGATTTTCAAGG - Intergenic
1144195710 17:12893090-12893112 TTCTCTGATGCTGCTCTAGTGGG + Intronic
1144296670 17:13882220-13882242 TTGTCTCGTGCTGGTTTTCAAGG - Intergenic
1144418112 17:15070798-15070820 TTGTCTGATCCTGCGACTCTTGG - Intergenic
1145107873 17:20135061-20135083 ATCTCTTATGCTGCTTTTCCTGG + Intronic
1145895178 17:28452937-28452959 TTGTCTTGTGCTGGTTTTCAAGG + Intergenic
1146584812 17:34073254-34073276 TTGTCTATGGCTGCTTTTCGGGG - Intronic
1147049611 17:37782748-37782770 TTGTCTTGTGCTGGTTTTCAAGG + Intergenic
1147500867 17:40962351-40962373 TAAGCTGATGCTGCATTTCTAGG - Intronic
1147964751 17:44188431-44188453 TTGTCTGACTCTGCTTTTGATGG + Intronic
1148876606 17:50691015-50691037 TCGTCTAATCCTGCTCTTCTGGG - Intronic
1150807983 17:68334275-68334297 TTCCCTGATGCTGTTTTTCAAGG - Intronic
1150853360 17:68726907-68726929 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
1151108445 17:71646851-71646873 TTGTCTCGTGCTGATTTTCAAGG - Intergenic
1153785723 18:8533166-8533188 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
1153857432 18:9164088-9164110 TTGTCTTGTGCTGGTTTTCAAGG + Intronic
1153875453 18:9366389-9366411 CTGTCTGATCCTGTTTTCCTGGG - Intronic
1154508100 18:15061969-15061991 TTGTCTGACGCAGTTTTCCTTGG + Intergenic
1155361080 18:25003536-25003558 TTGTCTGATGCTGCCAATCCAGG + Intergenic
1155463444 18:26109439-26109461 TTGTCTTTTGCTGGTTTTCAGGG + Intergenic
1155855724 18:30831776-30831798 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
1155949014 18:31887734-31887756 TTGTCTTGTGCTGGTTTTCAGGG - Intronic
1156762691 18:40612583-40612605 CTGCCTGATGCTTCTGTTCTTGG + Intergenic
1157343779 18:46804884-46804906 CTCTCTACTGCTGCTTTTCTTGG - Intergenic
1157597365 18:48871909-48871931 CTGTCTGCTGCTGATTCTCTTGG + Intergenic
1158367256 18:56751474-56751496 TTGGCAGATGCTGCCTCTCTGGG - Intronic
1158507963 18:58063517-58063539 TTTTCTAATATTGCTTTTCTTGG + Intronic
1158811567 18:61043626-61043648 TTGTCTATTTCTGCTTTTGTTGG - Intergenic
1159566108 18:70052021-70052043 TTGTGGGATGATACTTTTCTTGG - Intronic
1159601804 18:70435133-70435155 TTTGCTGATGCTACTTCTCTGGG + Intergenic
1159873243 18:73782462-73782484 TAGTCGGATGATGCTTCTCTAGG - Intergenic
1163964454 19:20731711-20731733 TTTTCTCATGCTGTCTTTCTTGG + Intronic
1164039217 19:21480188-21480210 TTGTCTCATTCTGGTTTTCAAGG + Intronic
1164605392 19:29594250-29594272 TTGTCTGATGTTGATTGTCTTGG - Intergenic
1166633949 19:44433004-44433026 TTGCTTGATGCTGCATATCTGGG - Intronic
1168229740 19:55022433-55022455 TTGTCTTGTGCTGGTTTTCAAGG - Intronic
926665681 2:15519776-15519798 TTTTCTGATGCTGCTGGTCAGGG + Intronic
926964233 2:18392591-18392613 TTGTCTTGTGCTGATTTTCAAGG - Intergenic
927437153 2:23076535-23076557 TTGTCTGTTGCAGCTTAGCTTGG - Intergenic
928083486 2:28330257-28330279 TTGTCTTGTGCTGGTTTTCAAGG - Intronic
928478784 2:31659256-31659278 TTGTCTTATTCTGGTTTTCAAGG - Intergenic
928485021 2:31721759-31721781 TTGTCTTGTGCTGCCTTTCAAGG - Intergenic
928900411 2:36311891-36311913 TTGTCTTGTGCTGTTTTTCAAGG - Intergenic
929132279 2:38588604-38588626 TTCATTGATGCTACTTTTCTGGG - Intronic
930450575 2:51531475-51531497 TTGTCTTGTGCTGGTTTTCAAGG + Intergenic
931419244 2:62110977-62110999 TTGTTTTATGGTGCTTTTCGTGG - Intronic
931454187 2:62394498-62394520 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
932380055 2:71274302-71274324 TTGTCTTGTGCTGCTTTTCAAGG - Intergenic
932657589 2:73623965-73623987 TTGTCTCAAGCTGACTTTCTTGG + Intergenic
932664262 2:73684246-73684268 TTGTCTCAAGCTGACTTTCTTGG + Intergenic
933365601 2:81349682-81349704 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
933606053 2:84385025-84385047 ATGTCTTATGCTGGTTTTCAAGG + Intergenic
934019408 2:87930134-87930156 TTGTCTTTTGCTGGTTTTCAAGG + Intergenic
934156328 2:89204243-89204265 TTATCTGATTCTGCTCATCTAGG - Intergenic
934210990 2:89978520-89978542 TTATCTGATTCTGCTCATCTAGG + Intergenic
935190712 2:100776565-100776587 TTGCCTAATGGTGCATTTCTTGG - Intergenic
935803146 2:106718878-106718900 TTGTCTTGTGCTGGTTTTCAAGG + Intergenic
935923249 2:108037942-108037964 TTGTCTTGTGCTGGTTTTCAAGG + Intergenic
936274880 2:111086732-111086754 TTGTCTTGTGCTGGTTTTCAAGG - Intronic
936862642 2:117035992-117036014 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
937126660 2:119478922-119478944 TTGTCTGATGCTGCTTTTCTTGG - Intronic
937575710 2:123418980-123419002 TTCTCTGATGGTACTTTCCTTGG - Intergenic
937586782 2:123561361-123561383 TTGTCTTGTGCTGGTTTTCAAGG + Intergenic
937607888 2:123824239-123824261 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
937768553 2:125691314-125691336 TTGTCTGAGGCTGAATTTTTTGG - Intergenic
937817677 2:126271285-126271307 GTGGCTGATGCTGCTTTCCTGGG + Intergenic
937994905 2:127685925-127685947 GTGTCTGCTGCTGTGTTTCTGGG + Intergenic
938254975 2:129850574-129850596 ATGGCTGATGCTGCTGTGCTAGG - Intergenic
939089402 2:137761215-137761237 TTGTCTTATGCTGGTTTTCAAGG - Intergenic
939236482 2:139500824-139500846 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
939288233 2:140160231-140160253 TTGTCTTGTGCTGGTTTTCAAGG + Intergenic
939365312 2:141222961-141222983 TTGTCTTGTGCTGGTTTTCAAGG - Intronic
939502167 2:143001333-143001355 TTGTCTTATGCTGTCTCTCTCGG + Intronic
939947981 2:148433417-148433439 TTGTCTTGTGCTGGTTTTCAAGG + Intronic
939975822 2:148716293-148716315 TTGTCTTGTGCTGGTTTTCAAGG + Intronic
940056969 2:149523867-149523889 TTGTCTTGTGCTGGTTTTCAAGG + Intergenic
940125176 2:150314757-150314779 TTGTCTTATGCTGGTTTTCAAGG - Intergenic
940579333 2:155557715-155557737 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
940629807 2:156223736-156223758 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
941743073 2:169056889-169056911 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
941981033 2:171457046-171457068 TTGTCTTGTGCTGGTTTTCAAGG + Intronic
942576610 2:177370274-177370296 TTGTCTTGTGCTGGTTTTCAAGG + Intronic
942581744 2:177426458-177426480 TTGTCTTATGCCGGTTTTCGAGG + Intronic
942769255 2:179496019-179496041 GTGTCTGAAACTGTTTTTCTAGG - Intronic
943158656 2:184217634-184217656 TTGTCTTGTGCTGGTTTTCAAGG + Intergenic
943167361 2:184346739-184346761 TTGTCTGGTGCTGGTTTCCAAGG + Intergenic
943455935 2:188106901-188106923 TTGTCTTATGCTGATTTTCAAGG - Intergenic
943500982 2:188689472-188689494 TTGTCTTCTGCTGGTTTTCAAGG + Intergenic
943717457 2:191167789-191167811 TTGTCTGTTGCTCTCTTTCTGGG - Intergenic
944180193 2:196882919-196882941 TTGTCTTGTGCTGGTTTTCAAGG + Intronic
944308705 2:198207598-198207620 TTGTCTTGTGCTGGTTTTCAAGG + Intronic
944979390 2:205097561-205097583 GTTTCTGATGCTGCTTGTCCAGG - Intronic
945005133 2:205397180-205397202 TTGTTTTATAATGCTTTTCTTGG + Intronic
945217197 2:207446413-207446435 TTCTTTGATACTGATTTTCTGGG - Intergenic
945775767 2:214104362-214104384 TGGTCTGATTCAGCTTTTGTTGG + Intronic
947123602 2:226843336-226843358 TTGTCTTGTGCTGGTTTTCAAGG + Intronic
947441986 2:230131494-230131516 TTCCCTGAGGCTCCTTTTCTTGG + Intergenic
947975259 2:234360272-234360294 TTGTCTTGTGCTGGTTTTCAAGG + Intergenic
948137787 2:235649705-235649727 TGTGCTGATGCTGCTTGTCTGGG + Intronic
1168864218 20:1071338-1071360 TTGTCTGATGCTCATATTGTAGG + Intergenic
1168933130 20:1640675-1640697 TTGTCTTGTGCTGGTTTTCAAGG + Intronic
1170051240 20:12147964-12147986 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
1170508372 20:17052338-17052360 TTGTCTTGTGCTGGTTTTCAAGG + Intergenic
1170984006 20:21241863-21241885 TTTTCTGCTTCAGCTTTTCTGGG + Intronic
1171233064 20:23502744-23502766 TTGTCTGATGGAACTTCTCTAGG + Intergenic
1171239827 20:23556848-23556870 TTGTCTTATGCTGGTTTTCAAGG + Intergenic
1174097336 20:48099690-48099712 TGCTCAGATGCTGCTTTTCAAGG - Intergenic
1174377908 20:50138693-50138715 CTGTCTGAGGCTGCTTTAATGGG + Intronic
1175139766 20:56852324-56852346 TTGACAGATGATGCTTTTTTAGG + Intergenic
1176089986 20:63314466-63314488 TTGTCTCTTGCTGGTTTTCCTGG + Intronic
1176180980 20:63749270-63749292 TTGTCTGAGGCTCTGTTTCTAGG - Intronic
1176789979 21:13309830-13309852 TTGTCTGACGCAGTTTTCCTTGG - Intergenic
1177086726 21:16714045-16714067 TTGTGTGGAACTGCTTTTCTAGG - Intergenic
1177117965 21:17108569-17108591 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
1177280343 21:18973872-18973894 TTGTCTTGTGCTGCTTTTCAAGG - Intergenic
1177351372 21:19946189-19946211 TTGTCTTTTGCTGGTTTTCAAGG + Intergenic
1177507576 21:22038467-22038489 TTGTCTTATTCTGGTTTTCGAGG + Intergenic
1177526748 21:22302773-22302795 TTGTCTTGTGCTGGTTTTCTAGG - Intergenic
1177618999 21:23562378-23562400 TTGTCTCGTGCTGGTTTTCAAGG + Intergenic
1179256239 21:39718415-39718437 TTGTCTTGTGCTGATTTTCAAGG + Intergenic
1182195381 22:28510592-28510614 TTGTCTTCTGCTGGTTTTCAAGG - Intronic
1182946689 22:34330872-34330894 CTGGCTGATGCTGCTGGTCTAGG - Intergenic
1184005059 22:41701620-41701642 AATTCTGAGGCTGCTTTTCTTGG + Intronic
1185408066 22:50667247-50667269 TGGTCTGATTCTGCTTTTCGTGG - Intergenic
949744112 3:7268652-7268674 TTCACTGTTTCTGCTTTTCTAGG - Intronic
950323340 3:12079368-12079390 TTGTCTTGTGCTGGTTTTCAAGG + Intronic
950989328 3:17415583-17415605 GTTTGTGATACTGCTTTTCTTGG - Intronic
951318445 3:21215478-21215500 TTGTCTTGTGCTGATTTTCAAGG + Intergenic
951649054 3:24928641-24928663 TTGTCTGCTTATGCTTTTCAAGG + Intergenic
951696750 3:25453203-25453225 TATTCTGATTCTGCATTTCTGGG + Intronic
951702370 3:25509345-25509367 TTGTCTGCTACTGCTTCTTTTGG + Intronic
951705585 3:25541104-25541126 TTGTCTAAAGCTGCTTTCCCAGG + Intronic
951748085 3:26001634-26001656 TTGTCTTGTGCTGGTTTTCAAGG + Intergenic
951997939 3:28752299-28752321 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
952026303 3:29086932-29086954 TTGTCTTGTGCTGGTTTTCAAGG + Intergenic
952502180 3:33973960-33973982 TTGCCTGATGTTGCATTGCTTGG - Intergenic
952518142 3:34126624-34126646 TTGTCTTGTGCTGCTTTTCAAGG - Intergenic
953970962 3:47346464-47346486 TTGGGTGATGCTTCTTTTCATGG - Exonic
954997018 3:54891082-54891104 TTTTCACATGCTGCTTTTGTTGG + Intronic
955168211 3:56536137-56536159 TCTTCTGAGGCTTCTTTTCTTGG + Intergenic
955759061 3:62258702-62258724 CTGTATGATGTTGCTTTTCACGG - Intronic
955937641 3:64117274-64117296 TTGTCTTATGCTGGTTTTCAAGG - Intronic
956475914 3:69620105-69620127 TTGTCTCTTGCTGCTTTTGGTGG - Intergenic
956510433 3:69987964-69987986 TTGTTTTATGCTGCTGTTTTCGG - Intergenic
956553710 3:70493072-70493094 ATGCTTAATGCTGCTTTTCTAGG + Intergenic
956690507 3:71873963-71873985 TTGGTTGCTGCTGCTTTTTTTGG - Intergenic
956854766 3:73265043-73265065 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
957004063 3:74923172-74923194 TCATCTGAGGTTGCTTTTCTGGG + Intergenic
957252448 3:77790980-77791002 TTGTCTTATGCTGCTTCCTTCGG - Intergenic
957396439 3:79645151-79645173 TGGTTTGATTTTGCTTTTCTAGG - Intronic
957872261 3:86104388-86104410 TTTTCTAAAGCAGCTTTTCTGGG - Intergenic
958015023 3:87930350-87930372 TTGTCTTGTGCTGGTTTTCAAGG + Intergenic
958015670 3:87937540-87937562 TTGTCTTGTGCTGGTTTTCAGGG - Intergenic
958453020 3:94297302-94297324 GTGCCTGATGCTTTTTTTCTGGG + Intergenic
958591128 3:96159336-96159358 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
958686882 3:97409551-97409573 TCTGCTGATGCTGATTTTCTAGG + Intronic
958940169 3:100303322-100303344 TTCTCTGATTTTGCTTTTCAAGG - Intronic
959301552 3:104608662-104608684 TTGTCTTATACTGGTTTTCAAGG - Intergenic
959363853 3:105431213-105431235 TTGTCTGCTGCTGAGTTTCATGG - Intronic
959439065 3:106354322-106354344 TTGTTTTGTGCTGCTTTTCTGGG + Intergenic
959828627 3:110832919-110832941 TTGTCTTATGCCAGTTTTCTAGG + Intergenic
959881775 3:111451736-111451758 TTGTCTTGTGCTGGTTTTCAAGG - Intronic
959929845 3:111967896-111967918 GTGTCTGAGGATGCTTTCCTGGG + Intronic
960119736 3:113935335-113935357 TTGTCAGATGCAGCTTTCCTGGG + Intronic
960305032 3:116050584-116050606 TGGTTTGCTGGTGCTTTTCTAGG - Intronic
960764247 3:121108279-121108301 TTGTCTTGTGCTGGTTTTCAAGG + Intronic
960782758 3:121338315-121338337 TTGTTTGATTCTTCTTTTCTTGG - Intronic
961979734 3:131064340-131064362 TTTTCTGAGGCTGCTCTCCTTGG + Intronic
962074072 3:132062313-132062335 TTGTCTTGTGCTGGTTTTCAAGG + Intronic
962451569 3:135522441-135522463 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
962691487 3:137903156-137903178 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
962939726 3:140114880-140114902 TTCTCTGATGTGGCTTTTCTAGG + Intronic
963304038 3:143630285-143630307 TTTTCTGCTGTTGCTTCTCTGGG - Intronic
963616034 3:147539275-147539297 TTGTCTTGTGCTGGTTTTCAAGG + Intergenic
963632330 3:147748768-147748790 TTGTCTTGTGCTGGTTTTTTAGG + Intergenic
963760290 3:149281384-149281406 CTGTCTGATGTTGGTGTTCTGGG - Intergenic
964252251 3:154732058-154732080 TTGTCTCTTGTTTCTTTTCTAGG + Intergenic
964294791 3:155221683-155221705 TTGTCTTGTGCTGGTTTTCAAGG + Intergenic
964630623 3:158805941-158805963 TTTTCTATTTCTGCTTTTCTTGG + Intronic
964807707 3:160629822-160629844 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
964878620 3:161398501-161398523 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
964992779 3:162835052-162835074 TTGTTTGTTCCTGCTCTTCTTGG + Intergenic
965147340 3:164923691-164923713 TTGTCTTATTCTGCTTCTCAAGG + Intergenic
965855724 3:173085582-173085604 TTGTCTTGTGCTGGTTTTCAAGG + Intronic
966329779 3:178798201-178798223 TTGTCTTGTGCTGGTTTTCAAGG + Intronic
966337534 3:178886077-178886099 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
966453741 3:180092107-180092129 TTGTCTTGTGCTGGTTTTCAAGG + Intergenic
967134302 3:186500271-186500293 TTGTCTTGTGCTGGTTTTCAAGG + Intergenic
967583127 3:191183578-191183600 ATGGCTGATGCTGCTTTTTGTGG - Intergenic
967750132 3:193104265-193104287 TTGTCTTGTGCTGGTTTTCAAGG + Intergenic
968019458 3:195371621-195371643 TTGTCTTATGCTGGTTTTCAAGG + Intronic
968129124 3:196182155-196182177 TCTTCTGAGGCTGCTTTTATGGG + Intergenic
968222138 3:196947382-196947404 TTGTCTGGTGAAGCTTTTCAGGG + Exonic
968383792 4:118266-118288 TTGTGTGATGTTGCTGTTTTGGG + Intergenic
968436771 4:595832-595854 TTGTCTTGTGCTGTTTTTCAAGG + Intergenic
970049714 4:11899677-11899699 TCTTCTGAGGCTTCTTTTCTTGG - Intergenic
970978407 4:22068966-22068988 TTCTCTGATGCTGCATCCCTTGG - Intergenic
970985840 4:22156846-22156868 TTGTCTCATTCTGGTTTTCAAGG + Intergenic
971107669 4:23544449-23544471 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
971624118 4:28896858-28896880 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
972674465 4:41246095-41246117 TTGTCTGCTGCTGGCTTTCAAGG - Intergenic
972933142 4:44100039-44100061 TTGTCTTGTGCTGGTTTTCAAGG + Intergenic
973054575 4:45640156-45640178 TTATCTGATTTTTCTTTTCTGGG + Intergenic
973298084 4:48549252-48549274 AATTCTGCTGCTGCTTTTCTGGG - Intronic
973867526 4:55128462-55128484 TTGTCTCCAGCTACTTTTCTGGG + Intergenic
973929213 4:55772974-55772996 TTGGCTTATCCTGTTTTTCTGGG - Intergenic
974302358 4:60084397-60084419 TTGTCTGCTCTTGCTTCTCTAGG - Intergenic
975048601 4:69831725-69831747 TTTTCAGATGCTGCTTAGCTAGG + Intronic
975070778 4:70135113-70135135 TTGTCTTATGCTGATCTCCTGGG - Intronic
975472366 4:74784491-74784513 TTGTCTTTTGCTGCTTTTTCAGG + Intronic
975704256 4:77096387-77096409 TTTTCTCAAGCTTCTTTTCTGGG + Intergenic
976994655 4:91415478-91415500 TTGTCTTGTGCTGGTTTTCAAGG + Intronic
977519245 4:98059987-98060009 TTGTCTTGTGCTGGTTTTCAAGG - Intronic
977737522 4:100434950-100434972 TTGTCTTGTGCTGGTTTTCAAGG - Intronic
977752407 4:100625225-100625247 TTGTCTTGTGCTGGTTTTCTAGG - Intronic
978045726 4:104124532-104124554 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
978140737 4:105314823-105314845 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
978148967 4:105411514-105411536 TTGTCTTGTGCTGATTTTCCAGG - Intronic
978224230 4:106315493-106315515 TTGTCAGTGGCTGCTTTTCAAGG - Intronic
978238107 4:106484767-106484789 TTGTCTTGTGCTGGTTTTCAAGG + Intergenic
978683399 4:111410856-111410878 TTGTCTTGTGCTGGTTTTCAAGG + Intergenic
978689414 4:111488349-111488371 TTGTCTTGTGCTGGTTTTCATGG - Intergenic
978923866 4:114218738-114218760 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
979158207 4:117425181-117425203 TTGTCTTGTGCTGGTTTTCAAGG + Intergenic
980021764 4:127719048-127719070 TTGTCTTGTGCTGGTTTTCAAGG + Exonic
980509611 4:133768232-133768254 TTGTCTTGTGCTGGTTTTCAAGG + Intergenic
981302215 4:143200457-143200479 TTGTCTTGTGCTGGTTTTCAAGG - Intronic
981454217 4:144934461-144934483 TTGTGTGCTCTTGCTTTTCTAGG + Intergenic
981509296 4:145538016-145538038 CTGTCTGGTGCTGCATTTGTGGG + Intronic
981606053 4:146541827-146541849 TTGTCTTGTGCTGATTTTCAAGG + Intergenic
981655318 4:147105946-147105968 TTGTCTTGTGCTGATTTTCAAGG - Intergenic
981664929 4:147213417-147213439 TTGTCTTGTGCTGATTTTCAAGG + Intergenic
981790616 4:148532513-148532535 TTGTCTTGTGCTGGTTTTCAAGG + Intergenic
981794091 4:148575366-148575388 TGATGTGATGCTACTTTTCTTGG - Intergenic
982142246 4:152335846-152335868 TTGTATGATTATGATTTTCTTGG + Intronic
982402402 4:154982795-154982817 TGTGTTGATGCTGCTTTTCTTGG + Intergenic
982524859 4:156466094-156466116 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
983134569 4:164064714-164064736 TTGTCTTGTGCTGATTTTCAAGG + Intronic
983379142 4:166968858-166968880 TTGAGTGTTGCAGCTTTTCTAGG - Intronic
983483535 4:168305245-168305267 TCGTCTAATGATGCATTTCTTGG + Intronic
983771952 4:171561802-171561824 TTTTCTGATGCTGCTATTACAGG - Intergenic
984359816 4:178714211-178714233 TTGTCTGATATTGATATTCTGGG + Intergenic
985236291 4:187878356-187878378 TTGTCTTCTGCTGGTTTTCAAGG + Intergenic
985277976 4:188257048-188257070 TTGCCTAATGATGCATTTCTTGG + Intergenic
985324336 4:188750929-188750951 TTGTCTTATGTTGGTTTTCAAGG + Intergenic
986491759 5:8299510-8299532 TTTAGTGATGCTCCTTTTCTTGG + Intergenic
987260781 5:16200493-16200515 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
987270017 5:16297791-16297813 TTGTCTGGTGCTGGTTTTCAAGG - Intergenic
987770173 5:22292370-22292392 TTGTCTATTTTTGCTTTTCTTGG - Intronic
987896616 5:23954184-23954206 TTGTCTTGTGCTGGTTTTCAAGG + Intronic
988028563 5:25731830-25731852 TTTTCTGAGGCTTCTTTCCTTGG - Intergenic
988336721 5:29917626-29917648 TTGTCTTGTGCTGCTTTTCAAGG - Intergenic
989251251 5:39318424-39318446 TTGTCTTGTGCTGGTTTTCAAGG + Intronic
989651342 5:43694346-43694368 TTGTCTTAGGCTGGTTTTCAAGG + Intronic
989657033 5:43755800-43755822 TTGTCTTGTGCTGGTTTTCAAGG + Intergenic
990024113 5:51164286-51164308 TTGTTTCATGCTGGTTTTCAAGG - Intergenic
990713744 5:58612890-58612912 TTGTCTTGTGCTGGTTTTCAAGG + Intronic
990765617 5:59178680-59178702 GTACCTGATGCTGCTCTTCTGGG + Intronic
990800762 5:59599961-59599983 TTGTCTCATGGTACTTTTGTGGG + Intronic
990852633 5:60224431-60224453 TTGTGTGATTCTGCTTCCCTTGG + Intronic
991154476 5:63415225-63415247 TTGTCTGAAGCTGCCCTTTTAGG - Intergenic
991346844 5:65677916-65677938 TTGTCTTGTGCTGGTTTTCAAGG - Intronic
991506654 5:67331667-67331689 TTGTCAAATGCTGTTTTTTTTGG + Intergenic
991651228 5:68856278-68856300 TTGTCTTGTGCTGGTTTTCAAGG + Intergenic
991984874 5:72274953-72274975 TTGTCTTGTGCTGGTTTTCAAGG - Intronic
992221937 5:74581758-74581780 TTCTTTGAGGCTGATTTTCTTGG - Intergenic
992265501 5:75014216-75014238 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
992757095 5:79917766-79917788 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
992845515 5:80743165-80743187 TTGTCTGAGCCTGCTTCTCCAGG + Intronic
993089098 5:83401527-83401549 CTGTCTGATGCAGCTTGTCAAGG + Intergenic
993407378 5:87528355-87528377 CTGTCTGATGTTGGTGTTCTAGG + Intergenic
993420338 5:87693766-87693788 TTGTCTTCTGCTGGTTTTCAAGG + Intergenic
993568558 5:89506841-89506863 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
993569778 5:89522732-89522754 TTGTCTAGTGCTCCTTTTCCAGG - Intergenic
993751811 5:91678663-91678685 TTGTCTTGTGCTGCTTTTCAAGG + Intergenic
993927085 5:93879406-93879428 TTGTCTTTTGGTGCTTTTGTTGG + Intronic
994238856 5:97396407-97396429 TTGTTTTATGGTGCTTTTCCTGG - Intergenic
994657541 5:102612261-102612283 TTGTCTTGTGCTGGTTTTCCAGG + Intergenic
994795437 5:104293055-104293077 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
994869005 5:105319599-105319621 TTGTCTGATGTTGGTTTTCTGGG + Intergenic
994970842 5:106734639-106734661 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
995255556 5:110042118-110042140 TTGTCTTGTGCTGGTTTTCAAGG + Intergenic
995357269 5:111253306-111253328 TGTGCTGATGGTGCTTTTCTAGG + Intronic
995691702 5:114833511-114833533 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
995695165 5:114870820-114870842 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
995856977 5:116603436-116603458 TTGTCTGGGGCTGCTTTCATGGG - Intergenic
996687838 5:126303707-126303729 TTGTCTTCTGCTGGTTTTCAAGG - Intergenic
997275904 5:132589475-132589497 TTGCCTAATGATGCATTTCTTGG + Intronic
998277834 5:140775482-140775504 TTGTCTTGTGCTGCTTTTCAAGG + Intergenic
998294691 5:140956214-140956236 TTGTCTTGTGCTGGTTTTCAAGG + Intronic
998343587 5:141440793-141440815 TTGAGTGATGCTGCTTTGTTGGG - Intronic
998774459 5:145583365-145583387 TTGTCTTGTGCTGGTTTTCAAGG - Intronic
999530742 5:152460927-152460949 TGTTCTGATGCTGCTTTAGTTGG + Intergenic
999984314 5:156988494-156988516 TTGTCTCATGTTGGTTTTCAAGG - Intergenic
1000273912 5:159715562-159715584 TTGTCTTCTGCTGGTTTTCAAGG + Intergenic
1000509971 5:162168681-162168703 TTGTCTTGTGCTGCTTTTCAAGG - Intergenic
1000634839 5:163632120-163632142 TTTTCTGTTGCTGCTTTTGGTGG + Intergenic
1001161798 5:169324677-169324699 GTGTCTGATGCTGGTTTTTCTGG + Intergenic
1001844374 5:174908453-174908475 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
1002546545 5:179949989-179950011 TTGTTTGAAGCTGTTTTCCTGGG + Intronic
1002967603 6:1982308-1982330 TTGTCTTGTGCTGGTTTTCAAGG - Intronic
1003200941 6:3959748-3959770 TTGCCTGAAGATGCTTTTCCTGG - Intergenic
1003826315 6:9956149-9956171 TTATCTGATGCTTCCTTTTTTGG + Intronic
1003956380 6:11169140-11169162 ATGTCTGATGCCGGATTTCTGGG + Intergenic
1005924065 6:30426802-30426824 TTGTCTGGTGCCGGTTTTCAAGG - Intergenic
1006167636 6:32074425-32074447 GTGTCTGAGGCTGCATTTGTTGG + Intronic
1007872707 6:45059511-45059533 TTGTCTTGTGCTGGTTTTCTGGG - Intronic
1008145927 6:47891363-47891385 TTGTCTGATGCTGTTTTGCGAGG - Intronic
1008206255 6:48661980-48662002 TTGCCTAATGCTGATTTGCTAGG + Intergenic
1009553600 6:65132634-65132656 TTGTCTTGTGCTGGTTTTCATGG - Intronic
1009597127 6:65750002-65750024 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
1009732341 6:67623839-67623861 TTGTAATAGGCTGCTTTTCTGGG + Intergenic
1009749563 6:67866522-67866544 TTGTCTTATGCTGGTTTTCAAGG - Intergenic
1010022408 6:71175911-71175933 ATGTGTGCTGCTGCTTTTCCAGG + Intergenic
1010520216 6:76823339-76823361 TTGTCTTGTGCTGGTTTTCTAGG + Intergenic
1010812080 6:80312492-80312514 TTGTCTTGTGCTGGTTTTCAAGG + Intronic
1011137571 6:84116556-84116578 TTGTCTTATGCCGATTTTCAAGG + Intergenic
1011254612 6:85407681-85407703 TTGGCTAATGCTGCTCTTGTGGG + Intergenic
1011427742 6:87249111-87249133 TTCTCTGTTGTTGCTTTTGTTGG + Intronic
1011446506 6:87447255-87447277 TTGTCTTGTGCTGGTTTTCAAGG + Intronic
1011628306 6:89301299-89301321 TTGTCTTGTGCTGGTTTTCAAGG - Intronic
1012345178 6:98176923-98176945 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
1012443863 6:99288960-99288982 TTGTATGATTCTGCCTTGCTTGG + Intronic
1012571821 6:100739007-100739029 TTGTCTTGTGCTGGTTTTCAAGG + Intronic
1012706870 6:102542518-102542540 TTGTCTTGTGCTGGTTTTCAAGG + Intergenic
1012870464 6:104667237-104667259 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
1012883531 6:104818963-104818985 TTGTCTTATGTTGGTTTTCAAGG - Intronic
1013220900 6:108076031-108076053 TTGTGTCATCCTGCTTTTCAGGG + Intronic
1013315067 6:108933732-108933754 TTGTCTTGTGCTGGTTTTCATGG + Intronic
1013741690 6:113294888-113294910 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
1014080212 6:117277742-117277764 TATGCTGCTGCTGCTTTTCTAGG - Intergenic
1014244004 6:119048304-119048326 TTGTCTTGTGCTGGTTTTCAAGG - Intronic
1014883529 6:126751492-126751514 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
1015247917 6:131095703-131095725 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
1015782163 6:136879874-136879896 TTGTGTGAATCTGCTCTTCTTGG + Intronic
1016212326 6:141553004-141553026 TTGTCTTTTGCTGTCTTTCTGGG + Intergenic
1016227619 6:141759456-141759478 TTGTCTTGTGCTGGTTTTCAAGG + Intergenic
1016601852 6:145871130-145871152 TTGTCTTGTGCTGGTTTTCAAGG - Intronic
1017614978 6:156236817-156236839 TTGTCTTGTGCTGGTTTTCAAGG + Intergenic
1018658218 6:166061073-166061095 TTGTCTTGTGCTGGTTTTCAAGG + Intergenic
1019157374 6:170048475-170048497 TTCTGTGATGCAGCTCTTCTGGG - Intergenic
1019909135 7:4088527-4088549 TTTTCTGATCCTGATTTCCTAGG + Intronic
1020378355 7:7513970-7513992 TTTTCTGATGCTGCTGCTCCTGG + Intronic
1020382298 7:7560068-7560090 TTGTCTTGTGCTGATTTTCAAGG - Intergenic
1020599294 7:10251907-10251929 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
1021075851 7:16303923-16303945 TTGTCTGAATGTGCTTTTTTAGG - Intronic
1021256685 7:18400782-18400804 TAGTCTGTTCCTCCTTTTCTGGG - Intronic
1021548640 7:21844789-21844811 CTGTGTGAGGCTGCTTTACTTGG + Intronic
1021833760 7:24646219-24646241 TTGTCTTGTGCTGGTTTTCAAGG + Intronic
1022888801 7:34674876-34674898 TTGCCTGAAGCTGGGTTTCTGGG - Intronic
1023241644 7:38154345-38154367 TTGTCTTGTGCTGGTTTTCACGG - Intergenic
1023592731 7:41796508-41796530 TTGTCTGACTCAGCATTTCTGGG - Intergenic
1023827185 7:44017512-44017534 GATTCTGATGCTGCTTATCTGGG - Intergenic
1024299735 7:47877740-47877762 TAGTCCGATGCTGCTGGTCTGGG - Intronic
1024564158 7:50667813-50667835 TTGCCTGCTGGTGTTTTTCTTGG - Intronic
1024624714 7:51196064-51196086 TTGTTTTATGCTGGTTTTCAAGG + Intronic
1024907571 7:54405306-54405328 TTGTCTTGGGCTGCTTTTCAAGG + Intergenic
1024990153 7:55227854-55227876 TTGTCTTGTGCTGGTTTTCAAGG + Intronic
1024998132 7:55290993-55291015 TTGTCTTCTGCTGGTTTTCAAGG + Intergenic
1025017872 7:55454874-55454896 TTGTCTTGTGCTGGTTTTCAAGG - Intronic
1025105566 7:56169323-56169345 TTCTCTGATGGGGCTTCTCTGGG - Intergenic
1025187533 7:56872704-56872726 TTGTCTGATGTTGATTACCTTGG - Intergenic
1025684390 7:63704216-63704238 TTGTCTGATGTTGATTACCTTGG + Intergenic
1026314656 7:69217841-69217863 TTCTCTGATGGGGCTTCTCTGGG - Intergenic
1027346765 7:77268331-77268353 TTGTCTGAAGTTGATGTTCTGGG + Intronic
1027767991 7:82369789-82369811 TTCTCTGAGTCTGCTTTTATAGG + Intronic
1027885587 7:83900631-83900653 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
1027900753 7:84111490-84111512 TTGCCTGATCCTTCTTTTATGGG - Intronic
1028780789 7:94733927-94733949 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
1029659539 7:101950620-101950642 TTGTCTGTGGCTGCTTTTCTGGG + Intronic
1029738337 7:102477258-102477280 GATTCTGATGCTGCTTATCTGGG - Intronic
1029755467 7:102570914-102570936 GATTCTGATGCTGCTTATCTGGG - Intronic
1029773416 7:102669994-102670016 GATTCTGATGCTGCTTATCTGGG - Intronic
1030234679 7:107245288-107245310 TTGTCTTGTGCTGGTTTTCAAGG - Intronic
1030250202 7:107435068-107435090 CTGTCTGATTCTACTTTTATGGG + Intronic
1030308126 7:108039839-108039861 TTGTCTTGTGCTGGTTTTCAAGG - Intronic
1030371435 7:108703932-108703954 TTGTCTTATGCTGATTTTCAAGG - Intergenic
1030374688 7:108741672-108741694 TTGTCTTATGCTAGTTTTCAAGG + Intergenic
1030376623 7:108760075-108760097 TTGTCTTATACTGGTTTTCAAGG - Intergenic
1030691839 7:112543520-112543542 TTGTCTTGTGCTGGTTTTCAAGG + Intergenic
1031183002 7:118440714-118440736 TTATCTTGTGCTGCTTTTCAAGG - Intergenic
1031246904 7:119325130-119325152 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
1031523505 7:122795784-122795806 TTGTCTTTTGCTGGTTTTCAAGG - Intronic
1031925630 7:127635748-127635770 AAGTCTTTTGCTGCTTTTCTAGG + Intergenic
1033379569 7:140801500-140801522 TTGTCGAAAGCTGCTTTTCCAGG - Exonic
1033522473 7:142175101-142175123 TTGTCTTGTGCTGGTTTTCAAGG + Intronic
1033548227 7:142421663-142421685 TTGACTGAAGCAGCTTTCCTGGG + Intergenic
1033784474 7:144714174-144714196 TTTTCTGATTCCACTTTTCTGGG + Intronic
1033794169 7:144827679-144827701 TTGACTGTTCATGCTTTTCTTGG - Intronic
1034216492 7:149410899-149410921 TTGTCTTGTGCTGGTTTTCAAGG + Intergenic
1035194177 7:157201566-157201588 TTGTCTGAGGCAGCTTTTTGTGG + Intronic
1035826342 8:2648041-2648063 TTGTCTAATTCTTCTTTTCTAGG - Intergenic
1036436999 8:8743700-8743722 CTGTCTGATGCTCCTTTGCCTGG + Intergenic
1038233175 8:25725010-25725032 TTGTCTTGTGCTGGTTTTCAAGG + Intergenic
1040533448 8:48284726-48284748 TTGTCTCATTCTGATTTTCAAGG - Intergenic
1040613827 8:49014565-49014587 TTGTCTTGTGCTGGTTTTCAAGG + Intergenic
1040689729 8:49921609-49921631 TTAGGTGATGCTGCATTTCTGGG + Intronic
1041309383 8:56499079-56499101 TTCTCTGTTGAAGCTTTTCTGGG + Intergenic
1041566997 8:59289907-59289929 TTGTCTGTGGCTGCTTTTAATGG + Intergenic
1041625707 8:60024252-60024274 TTGTCTTCTGCTGGTTTTCAAGG + Intergenic
1041859330 8:62494090-62494112 TTGTCTTGTGCTGGTTTTCAAGG + Intronic
1042046138 8:64654095-64654117 TTGTCTTGTGCTGGTTTTCAAGG - Intronic
1042186781 8:66143950-66143972 TGGTATGATGGTGCTTTGCTTGG + Intronic
1042585996 8:70339009-70339031 TTGTCTTATGCCGGTTTTCAAGG - Intronic
1042652716 8:71060691-71060713 TTGTCTGTTGTTTTTTTTCTAGG - Intergenic
1043133857 8:76496687-76496709 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
1043446647 8:80325713-80325735 TTCTCTGTTGCTGCTCTTTTTGG - Intergenic
1043754900 8:83990927-83990949 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
1043763500 8:84099704-84099726 TTGTCTTGTGCTGGTTTTCAAGG + Intergenic
1043806190 8:84674440-84674462 TTGTCTGGTGCTAGTTTTCAAGG + Intronic
1043845717 8:85161245-85161267 TTTTCTGAGGCCTCTTTTCTTGG - Intergenic
1044467043 8:92519425-92519447 TTCTCTGATTATGTTTTTCTTGG - Intergenic
1044793855 8:95876195-95876217 TTGTCTTGTGCTGATTTTCAAGG - Intergenic
1045346921 8:101301627-101301649 TTGCCTGTGGCTCCTTTTCTAGG - Intergenic
1045789844 8:105970282-105970304 TTGTCTTGTGCTGATTTTCAAGG - Intergenic
1045819760 8:106322472-106322494 TTGTCTTGTGCTGATTTTCAAGG - Intronic
1045870006 8:106915691-106915713 TTGTCATATGCTATTTTTCTTGG + Intergenic
1045889103 8:107133304-107133326 TTTTCTTGTGCTGCTTTTCAGGG - Intergenic
1046166266 8:110440301-110440323 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
1046196506 8:110870567-110870589 TTCTCTGATGTTCCTTTTTTAGG + Intergenic
1047281102 8:123446427-123446449 TTGTCTGTGGCTGCTGTTTTCGG - Intronic
1048346511 8:133579707-133579729 TTGCCTAATGACGCTTTTCTTGG + Intergenic
1048511424 8:135065827-135065849 TTGTGTAATGCTGCTTTTGTGGG + Intergenic
1050398478 9:5225789-5225811 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
1050408357 9:5334094-5334116 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
1050414792 9:5404702-5404724 TTGTCTTGTGCTGGTTTTCAAGG - Intronic
1050425230 9:5506097-5506119 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
1050623851 9:7482670-7482692 TTGTCTTGTGCTGGTTTTCATGG - Intergenic
1051089617 9:13391033-13391055 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
1051603691 9:18898875-18898897 TTGTCTTGTGCTGGTTTTCAAGG - Intronic
1051884602 9:21877424-21877446 TTGTCTTGTGCTGGTTTTCAAGG + Intronic
1052263386 9:26543879-26543901 TTGTCTTGTACTGCTTTTCATGG - Intergenic
1052301041 9:26952919-26952941 TAGTCAGCTGCTGCTTTTGTTGG - Intronic
1052482246 9:29046198-29046220 TTATCTTATGCTGGTTTTCAAGG + Intergenic
1052514463 9:29462355-29462377 TTGTCTTGTGCTGGTTTTCAAGG + Intergenic
1052999601 9:34570549-34570571 TTCTCTCAAGCTGTTTTTCTGGG - Intronic
1054189121 9:61974748-61974770 TTGTCTGATTCTGGGTTTCGGGG - Intergenic
1055133009 9:72796797-72796819 TTGTCTCGTGCTGGTTTTCAAGG - Intronic
1055342974 9:75305048-75305070 TTGTCTTTTGCTGGTTTTCAGGG + Intergenic
1055841919 9:80515497-80515519 TTGTCTTGTGCTGGTTTTCAAGG + Intergenic
1055842533 9:80522480-80522502 TATTCTGAGGCTACTTTTCTTGG - Intergenic
1055843059 9:80529558-80529580 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
1055884426 9:81043800-81043822 TTGTCTCCTGCTTCTATTCTCGG - Intergenic
1056096096 9:83255455-83255477 TTGTCTTGTGCTGGTTTTCAGGG - Intronic
1056105571 9:83343207-83343229 TTTTCTGATGCTGCCTACCTGGG - Exonic
1056143460 9:83707266-83707288 CGGGCTGATGCCGCTTTTCTCGG - Intronic
1056633021 9:88308939-88308961 TTTTCAGATGGTGCTTTTTTAGG + Intergenic
1057697249 9:97332935-97332957 TTGTCTTGTGCTGGTTTTCAAGG + Intronic
1059036400 9:110758494-110758516 TTGTCTTATTCTGGTTTTCAAGG - Intronic
1059262342 9:112990182-112990204 TTGTCTTGTGCTGGTTTTCAAGG + Intergenic
1060024048 9:120156170-120156192 TGGTCTTGGGCTGCTTTTCTAGG - Intergenic
1060901754 9:127263845-127263867 TTCTCTCATGCTGTCTTTCTTGG + Intronic
1060955395 9:127635244-127635266 CTGTCTGCTGCTGGGTTTCTGGG + Intronic
1061144710 9:128790884-128790906 TTGTCTGAGGGAGCTTTTCTGGG + Intronic
1186912999 X:14189678-14189700 TTGTCTGGTGCTGATTTTCAAGG + Intergenic
1186990823 X:15065560-15065582 ATGTAAGATGCTGTTTTTCTAGG - Intergenic
1187233254 X:17442597-17442619 TTGTCTGATGCAAATTTCCTTGG - Intronic
1187506634 X:19883643-19883665 TTGTCTGATGTTGGTTTTCTAGG - Intronic
1187818550 X:23259981-23260003 TTGTCTTGTGCTGCTTTTCAAGG - Intergenic
1188004826 X:25010126-25010148 TTTTCTGATCCTGCTTCTCTTGG + Intronic
1188118301 X:26273230-26273252 TGCACTGATGCTTCTTTTCTAGG + Intergenic
1188148356 X:26642239-26642261 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
1188669939 X:32869889-32869911 TTGTCTTGTGCTGGTTTTCAAGG - Intronic
1188738482 X:33747456-33747478 TTGTCTTCTGCTGGTTTTCAAGG + Intergenic
1188738844 X:33752197-33752219 TTCTCTTGTGCTGCTTTTCAAGG + Intergenic
1188743685 X:33816516-33816538 TTGTCTTGTGCTGGTTTTCAAGG + Intergenic
1188837989 X:34982214-34982236 TTGTCTTGTGCTGATTTTCAAGG - Intergenic
1189494733 X:41498758-41498780 TTTTCTGTTCCTGCTTTGCTGGG + Intergenic
1189581306 X:42409766-42409788 TTGTCTTGTGCTGGTTTTCAAGG + Intergenic
1189592063 X:42524073-42524095 TCCCCTGATGCTGCTTTTCATGG + Intergenic
1189933321 X:46038239-46038261 TTATCTGATTCTGATTTTATGGG - Intergenic
1190972164 X:55360574-55360596 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
1191046174 X:56139752-56139774 TTGCCTGTTTTTGCTTTTCTTGG - Intergenic
1191161819 X:57337829-57337851 TTGTCTTGTGCTGGTTTTCAAGG - Intronic
1191224017 X:58021316-58021338 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
1191598216 X:62971713-62971735 TTGTCTTATGCCACTTTTCAAGG - Intergenic
1191746061 X:64488503-64488525 TTGTCTTGTGCTGGTTTTCAAGG + Intergenic
1191774547 X:64799424-64799446 TTGTCTTGTGCTGGTTTTCAAGG + Intergenic
1191823978 X:65343749-65343771 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
1191888418 X:65914410-65914432 TTGTCTTGTGCTGATTTTCAAGG + Intergenic
1192128613 X:68526540-68526562 TTGTCTTGTGCTGGTTTTCAAGG + Intronic
1192284197 X:69717133-69717155 TTGTCTTGTGCTGGTTTTCAAGG + Intronic
1192293195 X:69819293-69819315 TTGTCTTGTGCTGGTTTTCAAGG - Intronic
1192774008 X:74223013-74223035 TTGTCTTTTGCTGCTTTTGAAGG - Intergenic
1192839696 X:74841545-74841567 TTGTCTTGTGCTGGTTTTCAAGG + Intronic
1192909012 X:75583554-75583576 TTGTCAAAAGCTGCTTTTCCAGG + Intergenic
1193090333 X:77487106-77487128 TTGTCTTATGCTGGTTTTCTAGG - Intergenic
1193314755 X:80051292-80051314 TTGTCTTGTGCTGGTTTTCGAGG + Intergenic
1193687496 X:84595576-84595598 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
1193893417 X:87080433-87080455 TTGTCTTGTTCTGCTTTTCAAGG + Intergenic
1194329782 X:92567693-92567715 TTGTCTTGTGCTGGTTTTCATGG + Intronic
1194357070 X:92898661-92898683 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
1194520360 X:94910548-94910570 TTGTCTTGTGCTGATTTTCAAGG - Intergenic
1194594401 X:95839021-95839043 TTGTATGATGCTGATTTTGGGGG - Intergenic
1194614826 X:96087596-96087618 ATGAATGCTGCTGCTTTTCTGGG - Intergenic
1194824946 X:98550427-98550449 TTGTCTTATTCTGGTTTTCAAGG + Intergenic
1194889206 X:99356370-99356392 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
1194930765 X:99884573-99884595 TTGTCTAGTGCTGGTTTTCAAGG - Intergenic
1194982702 X:100456701-100456723 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
1195170041 X:102258471-102258493 GTGTCTCTTGCAGCTTTTCTTGG + Intergenic
1195188816 X:102428629-102428651 GTGTCTCTTGCAGCTTTTCTTGG - Intronic
1195270498 X:103224384-103224406 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
1195305742 X:103581817-103581839 TTGTCTTGTGCTGGTTTTCAAGG - Intronic
1196052072 X:111316180-111316202 TTGTCTTGTGCTGGTTTTCAAGG - Intronic
1196132351 X:112170813-112170835 TTGTCTTGTGCTGCTTTTCAAGG + Intergenic
1196227746 X:113186851-113186873 TTGTCTTTTGCTGGTTTTCAAGG + Intergenic
1196228987 X:113199224-113199246 TTTTCTTATGCTGGTTTTCAAGG + Intergenic
1196414306 X:115454654-115454676 TTGTCTGCTGCTGCATCTCCGGG - Intergenic
1196693675 X:118587934-118587956 TAGTCTGATGCTGATTTTAGTGG - Intronic
1196949581 X:120863519-120863541 TTGTCTTGTGCTGATTTTCAAGG + Intergenic
1197115050 X:122821907-122821929 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
1197122649 X:122910187-122910209 TTGTCTTATGCCGGTTTTCATGG - Intergenic
1197158769 X:123299795-123299817 TTGTCTTGTGCTGATTTTCAAGG + Intronic
1197306577 X:124849604-124849626 TCATCTGATGATGCTCTTCTTGG - Intronic
1197440952 X:126489426-126489448 TATTCTGATGCTGCTGGTCTGGG - Intergenic
1197518026 X:127460905-127460927 TTGTCTTGTGCTGGTTTTCAAGG + Intergenic
1197790904 X:130252840-130252862 TTGTCTTGTGCTGGTTTTCCAGG - Intronic
1198337076 X:135676889-135676911 CTGTCTGATGCTCAGTTTCTAGG + Intergenic
1199117831 X:144013433-144013455 TTGTCTTGTGCTGGTTTTCAAGG + Intergenic
1199125118 X:144109007-144109029 TTGTCTTTTGCTGGTTTTCAAGG - Intergenic
1199311047 X:146319781-146319803 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
1199348843 X:146775686-146775708 TTGTCTTGTGCTGGTTTTCAAGG + Intergenic
1199506759 X:148571179-148571201 TTCTTTGGAGCTGCTTTTCTGGG + Intronic
1200035533 X:153326635-153326657 TTGTCTTGTGCTGGTTTTCAAGG + Intergenic
1200321194 X:155191735-155191757 TTGTCTTGTGCTGGTTTTCAAGG + Intergenic
1200591563 Y:5081935-5081957 TTGTCTTGTGCTGGTTTTCAAGG + Intronic
1200638484 Y:5686875-5686897 TTGTCTTGTGCTGGTTTTCATGG + Intronic
1200665402 Y:6015656-6015678 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
1201459846 Y:14210303-14210325 TTGTCTTATGCCGGTTTTCAAGG - Intergenic
1201688450 Y:16734205-16734227 TTGTCTTGTGCTGGTTTTCAAGG + Intergenic
1201690619 Y:16760723-16760745 GTGTCTTATGCTGCTAATCTAGG - Intergenic
1201960038 Y:19670130-19670152 TTGTCTTGTGCTGGTTTTCAAGG - Intergenic
1201973754 Y:19824178-19824200 TTGTCTTGTGCTGTTTTTCAGGG - Intergenic
1202050537 Y:20775989-20776011 TGGTCTAGTGCTGCTTTTCTTGG + Intronic