ID: 937128414

View in Genome Browser
Species Human (GRCh38)
Location 2:119489048-119489070
Sequence CTGGGTGCCCAGAGGGGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937128402_937128414 27 Left 937128402 2:119488998-119489020 CCGCCACGGGGAGAGTCTTTTCC No data
Right 937128414 2:119489048-119489070 CTGGGTGCCCAGAGGGGAGCAGG No data
937128404_937128414 6 Left 937128404 2:119489019-119489041 CCTCGAACCGTGAGAGCCCAACA No data
Right 937128414 2:119489048-119489070 CTGGGTGCCCAGAGGGGAGCAGG No data
937128403_937128414 24 Left 937128403 2:119489001-119489023 CCACGGGGAGAGTCTTTTCCTCG No data
Right 937128414 2:119489048-119489070 CTGGGTGCCCAGAGGGGAGCAGG No data
937128409_937128414 -10 Left 937128409 2:119489035-119489057 CCCAACAGGAATGCTGGGTGCCC No data
Right 937128414 2:119489048-119489070 CTGGGTGCCCAGAGGGGAGCAGG No data
937128406_937128414 -1 Left 937128406 2:119489026-119489048 CCGTGAGAGCCCAACAGGAATGC No data
Right 937128414 2:119489048-119489070 CTGGGTGCCCAGAGGGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937128414 Original CRISPR CTGGGTGCCCAGAGGGGAGC AGG Intronic
No off target data available for this crispr