ID: 937134628

View in Genome Browser
Species Human (GRCh38)
Location 2:119542222-119542244
Sequence GACCTTGATTAATCTAGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 68}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937134628_937134634 0 Left 937134628 2:119542222-119542244 CCTGGCCTAGATTAATCAAGGTC 0: 1
1: 0
2: 0
3: 8
4: 68
Right 937134634 2:119542245-119542267 TACTGTTAGAATTGGGGACTGGG 0: 1
1: 0
2: 0
3: 9
4: 196
937134628_937134633 -1 Left 937134628 2:119542222-119542244 CCTGGCCTAGATTAATCAAGGTC 0: 1
1: 0
2: 0
3: 8
4: 68
Right 937134633 2:119542244-119542266 CTACTGTTAGAATTGGGGACTGG 0: 1
1: 0
2: 0
3: 6
4: 207
937134628_937134631 -7 Left 937134628 2:119542222-119542244 CCTGGCCTAGATTAATCAAGGTC 0: 1
1: 0
2: 0
3: 8
4: 68
Right 937134631 2:119542238-119542260 CAAGGTCTACTGTTAGAATTGGG 0: 1
1: 0
2: 0
3: 12
4: 118
937134628_937134636 13 Left 937134628 2:119542222-119542244 CCTGGCCTAGATTAATCAAGGTC 0: 1
1: 0
2: 0
3: 8
4: 68
Right 937134636 2:119542258-119542280 GGGGACTGGGGAGAAACTTCAGG 0: 1
1: 0
2: 2
3: 31
4: 298
937134628_937134637 23 Left 937134628 2:119542222-119542244 CCTGGCCTAGATTAATCAAGGTC 0: 1
1: 0
2: 0
3: 8
4: 68
Right 937134637 2:119542268-119542290 GAGAAACTTCAGGAAAGCTGTGG 0: 1
1: 0
2: 0
3: 25
4: 372
937134628_937134632 -6 Left 937134628 2:119542222-119542244 CCTGGCCTAGATTAATCAAGGTC 0: 1
1: 0
2: 0
3: 8
4: 68
Right 937134632 2:119542239-119542261 AAGGTCTACTGTTAGAATTGGGG 0: 1
1: 0
2: 1
3: 14
4: 155
937134628_937134635 1 Left 937134628 2:119542222-119542244 CCTGGCCTAGATTAATCAAGGTC 0: 1
1: 0
2: 0
3: 8
4: 68
Right 937134635 2:119542246-119542268 ACTGTTAGAATTGGGGACTGGGG 0: 1
1: 0
2: 1
3: 16
4: 199
937134628_937134630 -8 Left 937134628 2:119542222-119542244 CCTGGCCTAGATTAATCAAGGTC 0: 1
1: 0
2: 0
3: 8
4: 68
Right 937134630 2:119542237-119542259 TCAAGGTCTACTGTTAGAATTGG 0: 1
1: 0
2: 0
3: 10
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937134628 Original CRISPR GACCTTGATTAATCTAGGCC AGG (reversed) Intergenic
902065550 1:13682897-13682919 GAACATGTTTAAGCTAGGCCAGG + Intergenic
905167232 1:36089801-36089823 CACCATGATTCCTCTAGGCCAGG + Intronic
906079279 1:43073410-43073432 CATCATAATTAATCTAGGCCGGG - Intergenic
913408929 1:118528749-118528771 GACCCTTATAAATCTAGGGCAGG + Intergenic
914674016 1:149893792-149893814 GAGATTTATAAATCTAGGCCGGG - Intronic
1063795193 10:9506913-9506935 GTCCTTAATTGACCTAGGCCGGG + Intergenic
1065974696 10:30831775-30831797 GAACTTGATTAATTTCAGCCAGG - Intronic
1068243307 10:54334147-54334169 GACCTTTCTTAATGGAGGCCAGG - Intronic
1069323725 10:67205177-67205199 GCCCTTAATTATTCTGGGCCAGG - Intronic
1069566456 10:69466518-69466540 GATCTTGATTAGTTTAGGTCAGG + Intronic
1078367130 11:10715970-10715992 GACCTTGAACAGTCTGGGCCTGG - Intergenic
1079911933 11:26321029-26321051 CATCTTGATTAAACCAGGCCAGG - Intronic
1081680791 11:45000980-45001002 GACCTTGAGTGAACTTGGCCAGG + Intergenic
1088236502 11:107730640-107730662 GACCCTCATTAATTCAGGCCCGG - Intergenic
1088433507 11:109784155-109784177 GGCCCAGATTAATCTGGGCCAGG + Intergenic
1096252760 12:50043865-50043887 GACCTTGATGAGTGTTGGCCTGG + Intergenic
1106026290 13:25958801-25958823 AACCTTTATTAATTTAGGACAGG + Intronic
1107302679 13:38982434-38982456 GACCTTGAGAAATTTAGTCCTGG - Intronic
1115025286 14:28737693-28737715 ATCCTTGATCAATATAGGCCTGG + Intergenic
1116774154 14:49160703-49160725 GACTTTGAATAATCTAGACTGGG + Intergenic
1117537888 14:56719264-56719286 GAACTGAATTAATCTAGGCCAGG + Intronic
1122485720 14:102078332-102078354 GATCTTGATGAATCTATGCCTGG + Intergenic
1123144407 14:106115044-106115066 GACATTAATAAAACTAGGCCAGG + Intergenic
1125913571 15:43464010-43464032 TATCTTGATTCATCTTGGCCTGG - Intronic
1127583797 15:60362537-60362559 GAGCTTGAAGAACCTAGGCCCGG - Intronic
1127649089 15:60988780-60988802 GACCTAGATTTATCTACTCCAGG + Intronic
1136694790 16:32067939-32067961 GACATTAATAAAACTAGGCCGGG - Intergenic
1136712988 16:32254664-32254686 GACCTGCATTAATCACGGCCCGG - Intronic
1136754928 16:32674774-32674796 GACCTGCATTAATCACGGCCCGG + Intronic
1136795291 16:33011201-33011223 GACATTAATAAAACTAGGCCGGG - Intergenic
1136813185 16:33195595-33195617 GACCTGCATTAATCACGGCCCGG - Intronic
1136819661 16:33305675-33305697 GACCTGCATTAATCACGGCCCGG - Exonic
1136826224 16:33362210-33362232 GACCTGCATTAATCACGGCCCGG - Intronic
1136831290 16:33460981-33461003 GACCTGCATTAATCACGGCCCGG - Exonic
1136874629 16:33843181-33843203 GACATTAATAAAACTAGGCCGGG + Intergenic
1139311795 16:66033757-66033779 GAACTTCATTGCTCTAGGCCAGG + Intergenic
1202991761 16_KI270728v1_random:18565-18587 GACCTGCATTAATCACGGCCCGG - Intergenic
1203057069 16_KI270728v1_random:935104-935126 GACCTGCATTAATCACGGCCCGG + Intergenic
1203097546 16_KI270728v1_random:1272861-1272883 GACATTAATAAAACTAGGCCGGG - Intergenic
1143948920 17:10617649-10617671 AACCCTCATTAATCAAGGCCAGG + Intergenic
1145021525 17:19435293-19435315 CAACTTGTTTAATCTTGGCCGGG - Intergenic
1147315248 17:39617277-39617299 GAACTTGATAGATCCAGGCCAGG - Intergenic
1150923624 17:69509651-69509673 GAACTTTATTAACCTAGGACTGG - Intronic
1151375047 17:73682673-73682695 GACCATCATTACTCTAGGCCAGG - Intergenic
1164415487 19:28043736-28043758 GACCTGGACCAATCTAGGACAGG + Intergenic
1166214062 19:41324363-41324385 GACCTTTGTGATTCTAGGCCTGG - Exonic
926319977 2:11742948-11742970 GACCTAGGCAAATCTAGGCCAGG - Intronic
927663208 2:25010257-25010279 GACCTTGTTTAGTCAAGGACAGG - Intergenic
930775233 2:55164212-55164234 GACCATGAGCATTCTAGGCCAGG + Intergenic
931810526 2:65850223-65850245 GACCTTGGAGATTCTAGGCCTGG + Intergenic
933313899 2:80693062-80693084 GACGTTTCTTAATCTAGCCCCGG - Intergenic
935294874 2:101640050-101640072 GAAGTTGATTATTGTAGGCCAGG - Intergenic
937134628 2:119542222-119542244 GACCTTGATTAATCTAGGCCAGG - Intergenic
946439263 2:219681254-219681276 GACTTTGATAAATCTATGCCTGG - Intergenic
1169892517 20:10468919-10468941 GACCTTGAATAATCTAAAGCAGG + Intronic
1170977819 20:21182941-21182963 GACTGTGATTAATCTAAGCCAGG - Intronic
951696576 3:25451118-25451140 CACCTTCCTTAATCTAGGGCAGG - Intronic
952563109 3:34619422-34619444 GAATTTGATTAATTTAGGCTTGG + Intergenic
972141745 4:35969214-35969236 GACCTTGAATTATCTAGGGCCGG - Intronic
976988952 4:91339821-91339843 GACAAAGATTAATTTAGGCCAGG + Intronic
977635793 4:99296740-99296762 TTCCTGGTTTAATCTAGGCCAGG - Intergenic
983365264 4:166778579-166778601 GGCCTTGATTATTCAAGGACAGG + Intronic
987344775 5:16969384-16969406 GAAATTGACTCATCTAGGCCAGG + Intergenic
988920061 5:35932911-35932933 AACCTAAAATAATCTAGGCCTGG + Intronic
993572562 5:89559827-89559849 GACATTAATTAAGCTAGGCAGGG - Intergenic
994507292 5:100657966-100657988 GACCTTCTATATTCTAGGCCCGG - Intergenic
999606336 5:153320804-153320826 GAACTTTCTTAGTCTAGGCCAGG - Intergenic
1005023918 6:21444898-21444920 GATGGTGATAAATCTAGGCCAGG - Intergenic
1013871069 6:114760547-114760569 GACTTTTATTAATATAGGCCGGG - Intergenic
1015557598 6:134479126-134479148 GCCATTGACTAATCTAGGGCAGG - Intergenic
1016036035 6:139384425-139384447 GAGCTTTATTATTCTTGGCCAGG - Intergenic
1032238383 7:130142825-130142847 GACCTTGGTTTGTCTGGGCCAGG + Intergenic
1038600557 8:28938009-28938031 GACCTTTATTAATTTAAGCCAGG + Intronic
1061697328 9:132386771-132386793 GACCTGGATTAACCTTGGGCTGG - Intronic
1062257202 9:135632457-135632479 GATTTTGATGAATCTACGCCTGG - Intronic
1188496129 X:30784715-30784737 GAACTTAAGAAATCTAGGCCAGG - Intergenic
1188918877 X:35947260-35947282 GAACTTGACTGATCTAGGCTGGG + Intronic