ID: 937134870

View in Genome Browser
Species Human (GRCh38)
Location 2:119544161-119544183
Sequence GGCGGAGCCGCCCGAGCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937134870_937134881 27 Left 937134870 2:119544161-119544183 CCACTGGCTCGGGCGGCTCCGCC No data
Right 937134881 2:119544211-119544233 TCTTGAAGGGTTCCAGTGTGTGG No data
937134870_937134877 14 Left 937134870 2:119544161-119544183 CCACTGGCTCGGGCGGCTCCGCC No data
Right 937134877 2:119544198-119544220 TCCCGCGCTCCGCTCTTGAAGGG No data
937134870_937134876 13 Left 937134870 2:119544161-119544183 CCACTGGCTCGGGCGGCTCCGCC No data
Right 937134876 2:119544197-119544219 CTCCCGCGCTCCGCTCTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937134870 Original CRISPR GGCGGAGCCGCCCGAGCCAG TGG (reversed) Intergenic