ID: 937138110

View in Genome Browser
Species Human (GRCh38)
Location 2:119572886-119572908
Sequence GGTGACTCCATTCCAAAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 156}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937138106_937138110 9 Left 937138106 2:119572854-119572876 CCACATTAACAACATTCACAGAA 0: 1
1: 0
2: 1
3: 19
4: 330
Right 937138110 2:119572886-119572908 GGTGACTCCATTCCAAAGCCAGG 0: 1
1: 0
2: 3
3: 12
4: 156
937138105_937138110 18 Left 937138105 2:119572845-119572867 CCTGCAGGGCCACATTAACAACA 0: 1
1: 0
2: 0
3: 9
4: 125
Right 937138110 2:119572886-119572908 GGTGACTCCATTCCAAAGCCAGG 0: 1
1: 0
2: 3
3: 12
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937138110 Original CRISPR GGTGACTCCATTCCAAAGCC AGG Intronic
900321704 1:2087798-2087820 GGGGACTCCTTTCCAGAGTCGGG - Intronic
904923604 1:34028551-34028573 AGTGACTCCATTTCACAGGCAGG - Intronic
905452399 1:38065041-38065063 GGTGTCCCAATTCCAAAGCTGGG - Intergenic
906511220 1:46411391-46411413 GGTGACTCCACAGCAGAGCCAGG - Intronic
910744482 1:90558450-90558472 GGGGACTGGTTTCCAAAGCCTGG - Intergenic
912933354 1:113983058-113983080 GGAGACTGGAGTCCAAAGCCTGG - Intergenic
919264041 1:195238054-195238076 GGTAACTCCTTTCCACAGGCAGG - Intergenic
921674652 1:217964811-217964833 GGTAACTCCTTTCCACAGGCAGG + Intergenic
921675258 1:217968950-217968972 GGTAACTCCTTTCCACAGGCAGG - Intergenic
922541629 1:226424625-226424647 GGGGAGTTCATTCCATAGCCTGG + Intergenic
1062771390 10:104454-104476 GGTAGCTCCTTTCCACAGCCAGG + Intergenic
1063275115 10:4557566-4557588 GGTCACTCCACTCCAAAGGGTGG + Intergenic
1063898216 10:10704607-10704629 GGAGACTCCACTCCACTGCCAGG - Intergenic
1066943621 10:41896396-41896418 GTTGACTCCATTCCATACCATGG - Intergenic
1066945715 10:41909815-41909837 GTTGACTCCATTCCATACCATGG - Intergenic
1068083631 10:52347964-52347986 GGTAGCTCCTTTCCATAGCCAGG - Intergenic
1068938480 10:62658227-62658249 GGTAACTCCTTTCCACAGACAGG - Intronic
1072072299 10:91930491-91930513 TGTGAAACCATACCAAAGCCAGG - Intronic
1074301765 10:112240027-112240049 GGTAGCTCCTTTCCACAGCCAGG + Intergenic
1078102069 11:8336010-8336032 GGGGACTTCATCCCAGAGCCTGG - Intergenic
1079099440 11:17531636-17531658 GTCTACTCCATTCCTAAGCCTGG - Intronic
1081082224 11:38756467-38756489 GGTGGCTCCTTTCCACAGGCAGG + Intergenic
1082740682 11:56907708-56907730 GTTGGTTTCATTCCAAAGCCTGG + Intergenic
1087407863 11:97752263-97752285 GGTAACTCCATTCCACAAGCAGG + Intergenic
1089081815 11:115782423-115782445 GGTGACACCATTGAAAAGTCAGG + Intergenic
1091704711 12:2685972-2685994 GGAGACAACATTCCAAAGGCAGG + Intronic
1091711284 12:2742311-2742333 GGAGACAACATTCCAAAGGCAGG + Intergenic
1094276188 12:28678103-28678125 ATTGACTTCATGCCAAAGCCAGG - Intergenic
1095826142 12:46531679-46531701 GGTAGCTCCTTTCCACAGCCAGG - Intergenic
1097282432 12:57853043-57853065 GGTCGCTGTATTCCAAAGCCCGG + Intergenic
1101535343 12:105611461-105611483 GCTGACTCCATGCCAAACTCTGG - Intergenic
1102340204 12:112115585-112115607 GGTGACTTCATTCCAAATCAAGG - Intergenic
1105221068 13:18327963-18327985 GGTCACCCCATTCCAAAGCATGG - Intergenic
1105761321 13:23517462-23517484 CGTGATTCCATTCCAATTCCAGG + Intergenic
1107400133 13:40061630-40061652 GGTGACTCTGTTGCAAAGCCAGG - Intergenic
1112842584 13:103599443-103599465 GGTGAATCAATTTCAAAGCTGGG - Intergenic
1115766321 14:36626812-36626834 GATGTCTCCAGTCCACAGCCAGG - Intergenic
1116724872 14:48550444-48550466 GGTGACTCCAAACAAAAGCAAGG + Intergenic
1116778216 14:49205814-49205836 TGTGACTCCATCTCAAAGACCGG - Intergenic
1123203320 14:106688867-106688889 GGTGCCTTAATTCCAAAGACAGG + Intergenic
1124634289 15:31355013-31355035 GGTGGCTCCAACCCCAAGCCCGG - Intronic
1124684330 15:31768139-31768161 GGTAACTTCATTCCACAGCTTGG + Intronic
1126845845 15:52759975-52759997 GGTGAATACACTCCAGAGCCTGG - Intronic
1127594817 15:60469577-60469599 GGTGACACCAATCCAAGGACCGG - Intronic
1127610034 15:60627594-60627616 GTTGACTAAATTCCAAAGCTGGG + Intronic
1127634612 15:60857461-60857483 GCTGGTTTCATTCCAAAGCCTGG - Intronic
1129893391 15:79086823-79086845 GGGGACTCCATGCCAAAGAAGGG + Intronic
1130829959 15:87589355-87589377 GGTGACTCTGTTGCAAAACCAGG + Intergenic
1131202670 15:90413303-90413325 GTTGACTACTTTCCAATGCCGGG - Intronic
1131457575 15:92595210-92595232 GGAGTCTCCAAACCAAAGCCTGG - Intergenic
1132584301 16:699680-699702 GGTGACTCCAGGACTAAGCCTGG + Intronic
1133076217 16:3283078-3283100 GATGAATCCTTTCCCAAGCCAGG - Exonic
1134856167 16:17521358-17521380 GGTGGCTTCACTCCCAAGCCAGG + Intergenic
1136467687 16:30456253-30456275 GATGACTCCCTTCAAAACCCTGG - Intergenic
1137273406 16:46917947-46917969 GCTGGCTCCATTGCCAAGCCAGG - Intronic
1138528426 16:57621859-57621881 GGTGACCCCATGCCAAGGCTGGG + Intronic
1138584977 16:57963627-57963649 GGAGATTCCATGCAAAAGCCTGG + Intronic
1140935479 16:79665867-79665889 GATGAGTCCATTACCAAGCCAGG - Intergenic
1142065462 16:88059868-88059890 GGTGACTCCATCCCAATGCCGGG - Intronic
1143568899 17:7742066-7742088 GGTGACACCCTTACAGAGCCTGG + Intronic
1144591539 17:16528392-16528414 GGTGACGCCATCCCATAGGCAGG + Intergenic
1145056849 17:19708462-19708484 GGAGTCCCCATTCCAAACCCCGG - Exonic
1146922915 17:36725615-36725637 GGTGATTCCATTGAGAAGCCTGG - Intergenic
1147591177 17:41684308-41684330 GGTGACAGCATCTCAAAGCCAGG + Intergenic
1148936611 17:51168220-51168242 GGTGCCTCCTCTCCAATGCCAGG + Exonic
1149679488 17:58495381-58495403 GGTGACTTCATTCCCAAGTGGGG - Exonic
1150191221 17:63241665-63241687 GGTGACTTGAATCCAACGCCAGG - Intronic
1151074850 17:71259409-71259431 GGTGATTCTGATCCAAAGCCAGG + Intergenic
1156392208 18:36660809-36660831 AGTGACCCCATCCCAATGCCAGG - Intronic
1160669299 19:349442-349464 GATGACGCCATTGCACAGCCTGG - Intergenic
1163587664 19:18172940-18172962 TGTCACTCAAATCCAAAGCCAGG + Intronic
1164211230 19:23099190-23099212 GGTGACTCATTTCTAAACCCAGG + Intronic
1164255213 19:23522315-23522337 GGTGACTCATTTCTAAACCCAGG - Intergenic
1167743234 19:51337250-51337272 AGGGACTCCATCACAAAGCCGGG - Exonic
1167853722 19:52221223-52221245 CATGTCTCCATTCCCAAGCCAGG - Intronic
925162845 2:1698094-1698116 GGTGCATCCCTTCTAAAGCCTGG + Intronic
930156923 2:48115304-48115326 GGTGGCTCCATTCCCAGGCATGG - Intergenic
932043258 2:68321409-68321431 GATGACTCCATTTTAAAACCTGG + Intergenic
932593520 2:73080715-73080737 GGTGACCACATCCCAAGGCCAGG + Intronic
933535121 2:83562684-83562706 GGTGACTCAATGCAAATGCCAGG - Intergenic
934046587 2:88177873-88177895 GGTGATTCCATTCCTTTGCCAGG - Intronic
934182989 2:89644505-89644527 GGTCACCCCATTCCAAAGCATGG + Intergenic
934293275 2:91718692-91718714 GGTCACCCCATTCCAAAGCATGG + Intergenic
937138110 2:119572886-119572908 GGTGACTCCATTCCAAAGCCAGG + Intronic
937167850 2:119837361-119837383 GGTGGCTCCTTTCCACAGGCAGG - Intronic
937988509 2:127649504-127649526 GGTGACCCCAATTCAAAGGCAGG + Intronic
940956921 2:159738547-159738569 GGTGGCTCCTTTCCACAGGCAGG + Intronic
943932209 2:193868461-193868483 GGTAACTCCTTTCCACAGTCAGG - Intergenic
944202880 2:197126662-197126684 GATGACTCCATTGCATAGCCAGG - Intronic
946644371 2:221817237-221817259 GATGACAGCACTCCAAAGCCAGG - Intergenic
947154259 2:227145569-227145591 GGTCACACCATTCCAAAGGATGG + Intronic
948311381 2:236989550-236989572 GGTGACCCCACTCCAACCCCAGG + Intergenic
948550275 2:238766169-238766191 GGTGCCTCATTCCCAAAGCCTGG - Intergenic
1169451237 20:5713450-5713472 GGAGACTCCATTCTAGAGGCTGG - Intergenic
1171028432 20:21653956-21653978 AGTGACTCCCTTCCGAACCCTGG - Intergenic
1172201485 20:33129781-33129803 GGTGACCCCAGTACAGAGCCTGG + Intergenic
1173884510 20:46445655-46445677 GGTAGCTCCTTTCCACAGCCAGG + Intergenic
1176429869 21:6568977-6568999 GGTGACTCCATTTCTAAGCCTGG - Intergenic
1179705263 21:43176439-43176461 GGTGACTCCATTTCTAAGCCTGG - Intergenic
1182254404 22:29027899-29027921 GATGACACCCTACCAAAGCCAGG - Intronic
1182667437 22:31970210-31970232 GGTGTCTCCCTTCCAAACTCAGG - Intergenic
1182865990 22:33605039-33605061 GATGACTCCATCTTAAAGCCTGG - Intronic
1183507994 22:38220058-38220080 GGTGACTGCAGCCCAAACCCAGG + Exonic
1184528152 22:45037658-45037680 GGTGACAGCATTCCAATGGCAGG + Intergenic
1184749065 22:46473753-46473775 GGTGGCTCCCATTCAAAGCCAGG + Intronic
950590381 3:13932560-13932582 GGAGACACCATTTCAAAGCGAGG - Intergenic
950710460 3:14810134-14810156 GGAGACACCATTTCAAAGCGAGG - Intergenic
952912237 3:38200613-38200635 ATTGTCTCCATTCCAAATCCAGG - Intronic
953250379 3:41240808-41240830 GGTGATTCAAATCCAAATCCAGG - Intronic
954360689 3:50121257-50121279 GTTTACTCCAATCCCAAGCCCGG + Intergenic
955961419 3:64344963-64344985 GGTGAGTCACTTCCAAAGGCAGG + Intronic
957112174 3:75976863-75976885 GGTTACTCCATACCATAGACTGG + Intronic
957417923 3:79929777-79929799 GGTAGCTCCTTTCCAAAGGCAGG - Intergenic
960956646 3:123036680-123036702 GGTGATTCCAATCCACAGCCAGG + Intergenic
961750244 3:129090156-129090178 GGAGACTCGATTCCATAGACTGG + Exonic
963129274 3:141843184-141843206 GTAGAGACCATTCCAAAGCCTGG - Intergenic
965206118 3:165720524-165720546 GCTGACTCCTTTCCATAGGCAGG + Intergenic
965738507 3:171848103-171848125 GGTAACTCAATTCCAAATACTGG + Intronic
967932536 3:194700695-194700717 GGCCACTCCAGTCCAAAGTCTGG + Intergenic
975683764 4:76899835-76899857 GGTGAGTCCATACCTAAGGCAGG + Intergenic
976713220 4:88095475-88095497 TGTGACTGCATTCCCAAGCTAGG - Intronic
978903558 4:113980370-113980392 GGTGTCTCCAGCCAAAAGCCTGG + Intergenic
983533523 4:168833557-168833579 GGTGACACCATTCCTTAACCTGG - Intronic
984939876 4:184921759-184921781 GGTGACCCCATTCCATTCCCAGG + Intergenic
986529551 5:8721884-8721906 GGTGAGTCAATCCCAAATCCAGG - Intergenic
987075857 5:14381126-14381148 CATGGATCCATTCCAAAGCCTGG - Exonic
987722380 5:21654695-21654717 GGTGACACCTTTCCAAAGAGAGG - Intergenic
989730435 5:44641672-44641694 GGTAACTCCTTTCCACAGGCAGG + Intergenic
990473796 5:56142436-56142458 GGTGATTCCATCGCAAGGCCAGG + Intronic
992982527 5:82191153-82191175 CGTGACTCCAATCAAAAGACTGG - Intronic
993577242 5:89617310-89617332 GGTGACTCAATTCTATAGCTGGG - Intergenic
998649957 5:144107516-144107538 GGTGCCCCCATTCCAAGGCCAGG + Intergenic
1002565709 5:180112165-180112187 GGTGACACCAGCCCAGAGCCAGG - Intronic
1003393854 6:5736283-5736305 GGTGTGTCACTTCCAAAGCCAGG - Intronic
1003665433 6:8107259-8107281 GGTGGTACCATTCAAAAGCCTGG - Intergenic
1004304557 6:14488094-14488116 GGTAGCTCCTTTCCACAGCCAGG - Intergenic
1007984276 6:46191892-46191914 AGTAACTCCATTCCAAGGCCTGG - Intergenic
1008139057 6:47810857-47810879 GGTGTCTCCATTACACAGCCAGG - Intronic
1009462948 6:63935915-63935937 GTTGCCTACATTCCAAACCCTGG - Intronic
1015950917 6:138551869-138551891 GTTTACTCCACTCCAGAGCCAGG + Intronic
1019209741 6:170395297-170395319 TGTGACTCCACTCCTGAGCCGGG + Intronic
1023726574 7:43148288-43148310 GGTGACTCACATCCAAAGACAGG - Intronic
1026334936 7:69385899-69385921 GGTGATTCTAATGCAAAGCCCGG + Intergenic
1026391994 7:69911604-69911626 GGTAACTCCTTTCCACAGGCAGG + Intronic
1027911852 7:84261120-84261142 GGTAGCTCCTTTCCACAGCCAGG - Intronic
1028816835 7:95156606-95156628 GGTAGCTCCTTTCCACAGCCAGG + Intronic
1029956266 7:104643608-104643630 GGTGATTCCAGTGCACAGCCAGG - Intronic
1032838289 7:135693812-135693834 TGTGAATTCCTTCCAAAGCCAGG - Intronic
1035061148 7:156070610-156070632 GGTGACTTCATTCCTAGGCCGGG + Intergenic
1035254172 7:157615517-157615539 GGTGACCCCATCGCAAGGCCGGG + Exonic
1035268065 7:157703203-157703225 GGTGACTCCACTCCGATGCCTGG + Intronic
1038521992 8:28241885-28241907 GGTGATTTGATTCCAAGGCCAGG - Intergenic
1041832848 8:62176322-62176344 TGTGGCTTGATTCCAAAGCCAGG + Intergenic
1041903109 8:63003855-63003877 TGTGTTTCCATTCTAAAGCCTGG - Intergenic
1042307732 8:67348884-67348906 GGAGACACCTTTACAAAGCCAGG + Intergenic
1042635634 8:70870360-70870382 AGTGACTACATTCCAGAGTCTGG + Intergenic
1048266470 8:132991732-132991754 GGGAACTCCACTCCCAAGCCAGG + Intronic
1053391484 9:37739545-37739567 GCTGGCACCATTCTAAAGCCTGG - Intronic
1053877287 9:42557783-42557805 GGTAACTCCTCTCCATAGCCAGG + Intergenic
1053895378 9:42736905-42736927 GGTAACTCCTCTCCATAGCCAGG - Intergenic
1054234406 9:62543939-62543961 GGTAACTCCTCTCCATAGCCAGG - Intergenic
1058727740 9:107819249-107819271 GGTGCCTCTAATCCAAAGACTGG - Intergenic
1059407681 9:114111970-114111992 GGTGACTCTAATGCACAGCCAGG + Intergenic
1060750222 9:126163904-126163926 GGGGACTCCATTCAACAGCTTGG - Intergenic
1061611505 9:131749707-131749729 GGTTACTCAATTCAGAAGCCTGG + Intergenic
1186051544 X:5601410-5601432 GATGAATCCATTGCACAGCCAGG + Intergenic
1186777181 X:12876828-12876850 TGTGATTCAATACCAAAGCCAGG + Intronic
1187264964 X:17723295-17723317 GGTGACCAAATTCCAAAGCACGG + Intronic
1198249991 X:134870556-134870578 GTTGGCTCCACTACAAAGCCAGG - Intergenic
1200749126 Y:6928953-6928975 GGTAACTCCTTTCCACAGGCAGG + Intronic
1201855624 Y:18537324-18537346 GGTAACTCCATTTCAAAAACAGG - Intergenic
1201877697 Y:18783061-18783083 GGTAACTCCATTTCAAAAACAGG + Intronic