ID: 937144234

View in Genome Browser
Species Human (GRCh38)
Location 2:119628375-119628397
Sequence CATTGTGCCCGAAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937144234_937144238 12 Left 937144234 2:119628375-119628397 CCTTCTTCCCTTCGGGCACAATG No data
Right 937144238 2:119628410-119628432 AAAAGTGAGAGTTAACCCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937144234 Original CRISPR CATTGTGCCCGAAGGGAAGA AGG (reversed) Intronic
No off target data available for this crispr