ID: 937144395

View in Genome Browser
Species Human (GRCh38)
Location 2:119629939-119629961
Sequence TCTGACCTGCAGATTGAAGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 226}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937144395 Original CRISPR TCTGACCTGCAGATTGAAGA AGG (reversed) Exonic
900207703 1:1438654-1438676 TCTGAGCTGCAGCTAGGAGATGG - Intronic
900598371 1:3492757-3492779 TCCGCCTTGCAGATTGCAGAAGG - Exonic
902051287 1:13565458-13565480 TCTTTCCTGAAGATTGAGGACGG - Intergenic
903406349 1:23100020-23100042 TCTGGCCTGGGGTTTGAAGAAGG - Intronic
903749748 1:25614032-25614054 TTAGACCTCCAGATTGCAGATGG + Intergenic
904096760 1:27985012-27985034 TTTGACATGCAGTTTGAATAGGG - Intronic
904376086 1:30083375-30083397 TCTGTCCTGCAGATGGAGAAAGG - Intergenic
904688994 1:32279829-32279851 TTTGGCCTGCAGATTGCAGAAGG + Exonic
905919918 1:41712610-41712632 TCTGCCCTTCTGAGTGAAGAGGG + Intronic
906066458 1:42984630-42984652 TCTCACCTGCAGAATGGGGAGGG - Intergenic
906204072 1:43977977-43977999 GCAGACCTCCAGAGTGAAGATGG + Exonic
907433536 1:54429237-54429259 TCTGAGCTGCTGATTGTATAGGG + Intergenic
909522173 1:76582160-76582182 TCTGACGTGCAGATGAATGATGG + Intronic
909583515 1:77263759-77263781 TCTGACTTACAGATTGACTATGG - Intergenic
910811688 1:91243847-91243869 ATTGACCAGCAGATTGTAGAAGG - Intergenic
911471684 1:98327044-98327066 TTTGACCAGCAGAATAAAGATGG + Intergenic
912056751 1:105609698-105609720 TCTGAACTGCAGATTGATTCTGG - Intergenic
912434344 1:109649500-109649522 TCTGCTCTGCAGATGGAAAATGG + Intergenic
912585454 1:110760581-110760603 TCTGAGTTGCTGATTAAAGAGGG - Intergenic
914820129 1:151095149-151095171 TCTGAACTGAATATTGAAGTAGG + Intronic
915742342 1:158128440-158128462 TATGGCCTCCAGATTGAAAAGGG + Intergenic
917539256 1:175897634-175897656 TCTGAGTTCCAGTTTGAAGAGGG - Intergenic
917750077 1:178045001-178045023 TCTTTCCTGAAGATTGAGGACGG - Intergenic
918489324 1:185063792-185063814 GCTGGCCTGAAGATGGAAGAAGG - Intronic
919144342 1:193614529-193614551 TCTCAACTGCAGATTCCAGAAGG - Intergenic
919426736 1:197441758-197441780 TCTGCCCTGCAGACTCCAGATGG + Intronic
920058035 1:203206744-203206766 TCTGAGATGCAGAATGAAAAAGG - Intergenic
923141828 1:231167048-231167070 TCTGACCTGCTGGGTGCAGATGG + Intronic
923630904 1:235649315-235649337 TGTGACCTACAAATGGAAGAGGG + Intronic
924676564 1:246184472-246184494 TCTGAGGTACAGATTGAGGATGG - Intronic
924937626 1:248785391-248785413 TCTTACCTGGAGGTAGAAGAAGG - Intergenic
1063065597 10:2605606-2605628 GGAGACGTGCAGATTGAAGAGGG + Intergenic
1063550788 10:7030901-7030923 TTTACCCTGCAGATTGGAGATGG + Intergenic
1063888201 10:10601151-10601173 TCAGTCCTGGAGAATGAAGAAGG - Intergenic
1065236861 10:23660757-23660779 TCTCCCCTGCAGATTGAGAATGG + Intergenic
1065257120 10:23881710-23881732 TCTGACCCACTGAATGAAGAGGG + Intronic
1065341551 10:24711443-24711465 TCTGACGTGGGGACTGAAGATGG - Intronic
1068313382 10:55308884-55308906 ACTGACCTCCAAATTGAACATGG - Intronic
1069237112 10:66090115-66090137 TCTGAGCTGCAGTTTGAAACTGG + Intronic
1069510009 10:69035118-69035140 GCTGACTTGCAGATCCAAGAGGG - Intergenic
1069858078 10:71452538-71452560 TCTGAGCTGCAGCTTGAAAGAGG - Intronic
1070279460 10:75038072-75038094 TCTTACCTGCAGATGGAGCAGGG + Exonic
1072988329 10:100164496-100164518 TTTGACATGCAGAATGAAGCTGG + Intronic
1073964689 10:108975821-108975843 TCTGAACTGCAGTTTGAGAAGGG + Intergenic
1075094582 10:119462432-119462454 TCTTACCTGCAAATGGAAGCAGG + Intergenic
1077187606 11:1242418-1242440 GCTGACCTGCAGCCTGGAGACGG + Exonic
1077260735 11:1618622-1618644 AGTGACCTGCAGATCAAAGATGG - Intergenic
1077869681 11:6251312-6251334 TCTGACCAGCAGAGAGCAGAAGG + Intergenic
1078231516 11:9448345-9448367 TCAGACCTGCAAATTAGAGAAGG + Intergenic
1080684152 11:34501738-34501760 TCTGACCTGCTCTTTGAAGCAGG - Intronic
1080955433 11:37088642-37088664 TCTGACAACCAGATTGAAAATGG - Intergenic
1081156287 11:39695933-39695955 TATGATCTGCAGAGTCAAGACGG - Intergenic
1082087873 11:48064920-48064942 TCTGAGCTGCAAATTTAATAGGG + Intronic
1084585425 11:70058796-70058818 CCTTTCCTGAAGATTGAAGACGG + Intergenic
1089200155 11:116719905-116719927 TCTGACCAGCTGCTGGAAGAAGG - Intergenic
1089657646 11:119962979-119963001 TTTGACCTGGAGATGGAAGCTGG + Intergenic
1090602729 11:128389722-128389744 TCTGACCTGGAGTGGGAAGAAGG + Intergenic
1090732436 11:129583360-129583382 TCTGATCTGCACTTTGAAAAAGG + Intergenic
1092059466 12:5536654-5536676 TCTGACCTGCAGTTTCAAGTTGG - Intronic
1094713562 12:32988723-32988745 TGTGACCTGAAGATTGAAAAGGG + Intergenic
1102684469 12:114713910-114713932 TCAGACCTGCAGCTTGAAGCAGG + Intergenic
1102984626 12:117268186-117268208 TCTGGATTTCAGATTGAAGAGGG + Intronic
1104634352 12:130428222-130428244 TCTGAAATGCAGCTGGAAGATGG - Exonic
1106516484 13:30459258-30459280 ACTAATCTTCAGATTGAAGAGGG + Exonic
1106699099 13:32209779-32209801 TCTGACTTGCAAATTGCACATGG - Intronic
1108707254 13:53000860-53000882 TCTGGCCTGCAGATGGAGCAAGG + Intergenic
1109686245 13:65823576-65823598 TCTGACTTCCACATTGAAGAGGG + Intergenic
1109717683 13:66237602-66237624 TCTGTGCTGCACATTGAAGAGGG - Intergenic
1113651032 13:112034374-112034396 TCTGACGTTCAGATTCCAGATGG + Intergenic
1115658678 14:35468484-35468506 GCTGATCTGCAGAATGATGAAGG + Intergenic
1116916901 14:50533346-50533368 CCTTATCTGCAGCTTGAAGAGGG + Intronic
1117838326 14:59830736-59830758 TCTGATCTGCAAAATGAGGATGG + Intronic
1118673422 14:68156023-68156045 TCTGTCTTGCACTTTGAAGAGGG + Intronic
1118885363 14:69861260-69861282 TCTGACATTCAGATTTAACAAGG + Intronic
1119799981 14:77435360-77435382 TCTGTCCTGCTGATTCTAGATGG + Exonic
1120885823 14:89451036-89451058 TCTGCCCCACAGATTGCAGATGG - Intronic
1121020879 14:90579318-90579340 TCTGGCCTGCAGGTGGGAGAAGG - Intronic
1121298201 14:92847352-92847374 TCTGAGCTGCAGACTGCAGGAGG + Intergenic
1121821184 14:96967713-96967735 TCTGACATTCAGATTTAACAGGG - Intergenic
1125675678 15:41501488-41501510 TATGACCGGCAGATTGACCATGG - Exonic
1127385914 15:58466800-58466822 TATGACCTGCAAAGAGAAGAAGG - Intronic
1129259819 15:74358862-74358884 CCTTTCCTGAAGATTGAAGACGG - Intronic
1130515576 15:84623530-84623552 TCGCACCTGGAGAGTGAAGACGG + Exonic
1132011364 15:98279477-98279499 TCTGATCTGCAGAGAGAAGGTGG + Intergenic
1132979815 16:2731573-2731595 CCAGACCTGCAGATGAAAGAAGG + Intergenic
1134053619 16:11155446-11155468 TCTCCCCTGCAGATAGCAGAAGG + Intronic
1135889778 16:26346665-26346687 TCTGACCTGCATGTTGGAGCGGG + Intergenic
1136118618 16:28113045-28113067 TTGGACCTGCAGAGGGAAGAGGG + Exonic
1137894291 16:52194509-52194531 TTAGACCTGCAGATTGATGCTGG + Intergenic
1137943763 16:52714450-52714472 TCTGACCTGGAAAATGAGGAGGG - Intergenic
1138212586 16:55175767-55175789 TCAGAACTGCAGATTCAGGAGGG + Intergenic
1138214507 16:55191482-55191504 TCTGATCAGCATATTGTAGAAGG + Intergenic
1138339081 16:56276850-56276872 TGGGACCTGGAGATTGGAGAAGG + Intronic
1138415978 16:56871521-56871543 TCTGACCTGCAGCTGTCAGAGGG + Intronic
1138653245 16:58473791-58473813 TCTGTTCTGCACATTGCAGAAGG + Intronic
1139263782 16:65621215-65621237 TCCGACCTGGAGATTGATGATGG - Intergenic
1140616073 16:76665841-76665863 ACTGAGCTGCAGACTGCAGAAGG - Intergenic
1145320027 17:21760760-21760782 ACTGACATCCAGATAGAAGATGG + Intergenic
1147052117 17:37803067-37803089 TGTGACATGCACATTGAGGAGGG + Intergenic
1147216228 17:38900733-38900755 GTTGACCTGCAGTTTGAAGTTGG + Intronic
1147498198 17:40937501-40937523 TGTGACCTGCAGAGGGACGATGG + Intronic
1147600301 17:41741043-41741065 TCTGAGCTGAGGCTTGAAGAAGG - Intergenic
1149430083 17:56590541-56590563 TCAGAACTTCACATTGAAGAGGG + Intergenic
1150223727 17:63511368-63511390 TATGACCAGCAGACTGAAGCTGG - Intronic
1151157565 17:72137114-72137136 TCTGGCTTGGAGAGTGAAGAGGG + Intergenic
1151794064 17:76330753-76330775 TCCTACCAGCAGACTGAAGACGG + Intronic
1152076631 17:78164116-78164138 TCTGTCCTGCAGAGTGAAGTTGG - Exonic
1152240880 17:79160367-79160389 TCTGCCCTGCAGCTTGAGGTGGG - Intronic
1152993492 18:384440-384462 TGTTACCTGCAGATAGATGAAGG + Intronic
1154124140 18:11674581-11674603 TCTGAAATGCAGACTGAAGGTGG + Intergenic
1154310773 18:13264626-13264648 ACTGCCATGCAGGTTGAAGACGG + Intronic
1157370819 18:47109698-47109720 TCTGACCTGAAGCATGAAGGAGG - Intronic
1157500622 18:48188088-48188110 TCTGACTTCCAAAATGAAGATGG - Intronic
1158020355 18:52834187-52834209 TCTGTGATGCTGATTGAAGATGG - Intronic
1158561479 18:58517282-58517304 GCTGACCTGCAGAACCAAGAGGG + Intronic
1162295495 19:9810818-9810840 TCTGAGCAGCACCTTGAAGAGGG - Exonic
1163200082 19:15760611-15760633 TCAGACCAGCAGATGGAGGAGGG + Intergenic
1163667084 19:18608204-18608226 TCTGAACTGGAGATTTAAGTAGG - Intronic
1164649384 19:29881016-29881038 TCTGAGCTGCAGCTGGGAGAGGG + Intergenic
1167130927 19:47585237-47585259 ACTGAGCTGAAGATGGAAGACGG - Intergenic
1167411738 19:49348067-49348089 TCTGGCCAGCAGATGGAGGAAGG - Intronic
925707578 2:6701689-6701711 TCTGACCTGCAAACTGAACCAGG + Intergenic
927523692 2:23718833-23718855 TGTGATCTGAAGATGGAAGAAGG - Intergenic
927756999 2:25716734-25716756 TCTGACTAGCAGATTGGAGGTGG - Intergenic
928081449 2:28316158-28316180 TCTGACATTCAGATTTAACAAGG + Intronic
928950760 2:36811179-36811201 TCATATCAGCAGATTGAAGACGG + Intronic
929500131 2:42483275-42483297 TCTGACTTGCATATTTTAGACGG + Intronic
929610812 2:43269442-43269464 ACTGGCCAGCAGATCGAAGACGG + Intronic
931652694 2:64482827-64482849 TTTGACTTGAAGACTGAAGAAGG + Intergenic
932015579 2:68023616-68023638 TCTGAACAGCACCTTGAAGAGGG - Intergenic
932591245 2:73069205-73069227 TCTGACTTGCAGAAAGAGGAAGG + Intronic
937028789 2:118720966-118720988 TCTGACCTAGAGATAGAGGAAGG - Intergenic
937144395 2:119629939-119629961 TCTGACCTGCAGATTGAAGAAGG - Exonic
943235949 2:185319764-185319786 CCTTATCTGCAAATTGAAGATGG + Intergenic
944340235 2:198587420-198587442 AGTGGCCTCCAGATTGAAGACGG + Intergenic
945229948 2:207576672-207576694 TCTGAACGTCAGTTTGAAGATGG + Intronic
948041151 2:234902593-234902615 TCTGACCTGGAGAGGGAGGAGGG + Intergenic
1169941170 20:10938875-10938897 TCAGATCTGCAGAATGAAGGGGG - Intergenic
1170738511 20:19031859-19031881 TCTGACTTGCAGAGTGTGGAAGG - Intergenic
1171970859 20:31564191-31564213 TGTGCCCTGCATACTGAAGAGGG - Intronic
1172010586 20:31843784-31843806 TCTGACCTGCAGCTTGAGTGAGG - Intergenic
1173377345 20:42498335-42498357 TCTAACCTCCAGAGGGAAGAGGG - Intronic
1173652514 20:44675784-44675806 TCTTTCCTGAAGATTGAGGACGG - Intergenic
1177010763 21:15728872-15728894 TCTGAGCTGCAGAACAAAGATGG + Intergenic
1177242452 21:18477060-18477082 TCTGACTTGCAGAGTAATGAGGG + Intronic
1177451786 21:21278031-21278053 TGTTAACTGCAGGTTGAAGATGG + Intronic
1179354881 21:40649922-40649944 ACAGACCTGGAGATTGCAGAAGG + Intronic
1182871500 22:33651514-33651536 TCTTGCCTGCAAATGGAAGAAGG - Intronic
1183331665 22:37225674-37225696 TCTGGCCTGCAGTTTCCAGAGGG + Exonic
1183356551 22:37362823-37362845 TCTGTCCTGCAGCTTTAAGAGGG - Intergenic
1183858915 22:40654919-40654941 TCTGAACTGCAGTGTGAAGATGG - Intergenic
1184032391 22:41902736-41902758 TCTCACCTGCAGAATGGGGAGGG + Intronic
949448441 3:4161332-4161354 TCCCACCTGCTGATTGTAGAGGG - Intronic
949711714 3:6878230-6878252 GCTGTCCTTCTGATTGAAGATGG + Intronic
950252264 3:11475594-11475616 GCTGATCTGCAGACTGCAGAGGG - Intronic
950365370 3:12479851-12479873 TCTCACCAGCAGAGTGAAGCTGG + Intergenic
952178571 3:30894086-30894108 TCAGAGCTGCAGATTGAGAACGG - Intronic
952386871 3:32848315-32848337 TCTGACCTGTAGAACTAAGAGGG - Intronic
952888852 3:38028238-38028260 TCTGGCCTGAAGAAAGAAGAGGG + Intronic
953091785 3:39734531-39734553 TGTAATCTGAAGATTGAAGATGG - Intergenic
955877195 3:63504434-63504456 ACAAACCTGCAGAGTGAAGAAGG - Intronic
955931988 3:64066592-64066614 ACTGAACTGCAGAATGGAGAAGG + Intergenic
956200371 3:66699360-66699382 TTTGACCTGGAGAATGAAAAAGG + Intergenic
956786546 3:72647580-72647602 TCAGGCCTGCAGATTCAGGATGG + Intergenic
957980516 3:87503747-87503769 TCTGGACTGCATATTGAATATGG - Intergenic
958455433 3:94325344-94325366 TCTCACCTGCAAAATGGAGATGG + Intergenic
959466981 3:106700478-106700500 TCTGACCAGTAGATTCAAGAGGG + Intergenic
961978723 3:131054356-131054378 TCAGGCCTGCAGATTTATGAGGG - Intronic
962523521 3:136218410-136218432 CCTTTCCTGAAGATTGAAGACGG + Intergenic
962768252 3:138587201-138587223 TCTGAAATGAAGATTAAAGAAGG + Intronic
962928149 3:140013863-140013885 TCTGACCTTCAGTTAAAAGAAGG - Intronic
964098434 3:152961176-152961198 TCTTACCTGCAGAATGTACAGGG - Intergenic
965637764 3:170801725-170801747 TCTGCCCTGGACACTGAAGAGGG + Intronic
965861554 3:173156429-173156451 CCTTTCCTGAAGATTGAAGACGG + Intergenic
968611195 4:1557876-1557898 TCAGACCTGAAAATTAAAGAAGG + Intergenic
968846120 4:3042439-3042461 CCTCAGCTGCAGAATGAAGATGG + Intergenic
968899427 4:3424057-3424079 TCTCACCTGCACTTTGTAGATGG + Intronic
972647508 4:40982967-40982989 CCTGACCTGCAGGGTGAAGGTGG + Intronic
972766182 4:42153495-42153517 TCTGACCTGGAGAACGAAAAAGG - Intergenic
977736559 4:100424077-100424099 TCAGTCCTTCTGATTGAAGATGG - Intronic
981005295 4:139868243-139868265 TATGCCTTGCAGATTGAACAGGG - Intronic
984710342 4:182879343-182879365 TCTGCCCTGGAGATGGAAAAGGG + Intergenic
985002045 4:185495261-185495283 TCACACCTGAAGATTCAAGATGG - Intergenic
987288183 5:16480926-16480948 ACAGACCTGTAGTTTGAAGAGGG - Intronic
988536156 5:32071015-32071037 TCTGCTCTGTAGATTGAAGAAGG + Intronic
989661426 5:43802486-43802508 ACTAACCTGCAGAATGAGGAAGG + Intergenic
989707424 5:44353205-44353227 TCTTACATGGATATTGAAGAGGG - Intronic
996394090 5:122995090-122995112 ATTGACTTGCAGATTGGAGATGG - Intronic
997719647 5:136067193-136067215 TGAGACCTGAAGAATGAAGAGGG + Intergenic
998192490 5:140038880-140038902 GCTGTGCTGCAGCTTGAAGATGG - Intronic
1001013206 5:168117195-168117217 TCTCACCAACAGATGGAAGAGGG + Intronic
1001301815 5:170539027-170539049 TAGGACCTGCAGATTGCATATGG - Intronic
1003132192 6:3404384-3404406 TCTCACCTGCATATTAAAAATGG - Intronic
1003885601 6:10518835-10518857 ACTGTCCTGGAGATTCAAGACGG - Intronic
1003954562 6:11149780-11149802 TGTGACCTCCAGACTGCAGAAGG - Intergenic
1004433367 6:15566455-15566477 TCTAAACTCCAGAATGAAGAAGG - Intronic
1006183901 6:32169621-32169643 TCTGAACTGGGGATTGGAGAAGG - Intronic
1007163256 6:39810022-39810044 CCTGGAATGCAGATTGAAGATGG - Intronic
1007843357 6:44734711-44734733 TGTGACCTTCAGATCAAAGAAGG + Intergenic
1010759462 6:79706430-79706452 ACTGTTCTGCAGATTGTAGATGG - Intergenic
1011166025 6:84447347-84447369 TCTTACCTGTAGAATGAACATGG + Intergenic
1013119265 6:107126833-107126855 TCTGACCTGCAGATGGGATTTGG - Intergenic
1013304418 6:108835178-108835200 TCTGAACTGCATTTTGAAAAGGG + Intergenic
1013822948 6:114177131-114177153 TTTGACATCCAGATTCAAGAAGG + Intronic
1014830403 6:126096441-126096463 TCTCAGCAGCAGATTGAAGTTGG + Intergenic
1017137523 6:151161409-151161431 ACTGTCCTGCTGCTTGAAGAGGG - Intergenic
1017448260 6:154529226-154529248 TCTGTTCTCCACATTGAAGATGG + Intergenic
1017682103 6:156874456-156874478 TCTCACCTGTAGAGTGAAGTTGG + Intronic
1021959641 7:25858865-25858887 TCTGGCGTGCTGTTTGAAGAAGG + Intergenic
1024067226 7:45750093-45750115 TCTGAAATGCATATTGAAAAAGG + Intergenic
1024435243 7:49345290-49345312 GCTAACCAGCAGATCGAAGAAGG + Intergenic
1025732792 7:64121344-64121366 TCTCACGTGCAGATGGATGAGGG + Intronic
1028713833 7:93941146-93941168 TTTGACCAACAGAGTGAAGAAGG - Intergenic
1031492902 7:122411119-122411141 TCTGATCTGCTGATGGTAGATGG - Intronic
1031601382 7:123714849-123714871 TCTTACCTGAAGAATGAAAAAGG + Intronic
1038925213 8:32131389-32131411 TCTGCCCTGCAGTTTAAAGAAGG - Intronic
1041299395 8:56394911-56394933 TCTGACATGCAGAATCAAGCAGG + Intergenic
1042706526 8:71669559-71669581 CCTTTCCTGAAGATTGAAGATGG - Intergenic
1043548667 8:81344051-81344073 TCTGACCTGTAGACTGGAAATGG - Intergenic
1046645566 8:116782114-116782136 TCTGCCCTGCAGGTTTCAGAGGG - Intronic
1047667161 8:127104741-127104763 ACTGACCTGCTGGTTGATGAAGG - Intergenic
1049483176 8:142837262-142837284 TCTGTCCTGCAGGTTGGAGTTGG - Intronic
1049552752 8:143267959-143267981 TCTGAGCTCCAGACTGAAGGGGG - Intronic
1049720684 8:144114146-144114168 TCCAACCTGCAGGCTGAAGATGG - Exonic
1050079036 9:1895420-1895442 GATGACCTACAGATTGAAGAGGG + Intergenic
1050601966 9:7261975-7261997 TGGCACCTGCAGATTGAAAAAGG - Intergenic
1051572698 9:18578366-18578388 TCTGAGATGCAGGGTGAAGAGGG - Intronic
1052186980 9:25609892-25609914 TCATACCTGGAGATAGAAGAAGG + Intergenic
1055844461 9:80544680-80544702 TTTGACTTGAAGATTGAGGAAGG - Intergenic
1055920790 9:81458938-81458960 TCTGAGCTGCAGTCTCAAGAAGG + Intergenic
1056153860 9:83816333-83816355 TGGGAGCTGCAGATTGGAGAGGG - Intronic
1056356635 9:85806775-85806797 TGGGAGCTGCAGATTGGAGAGGG + Intergenic
1056820606 9:89839357-89839379 ACTGACATGCACATAGAAGAAGG - Intergenic
1057363354 9:94395805-94395827 TCTGGCCTGCAGTCTCAAGATGG + Intronic
1057659983 9:96992293-96992315 TCTGGCCTGCAGTCTCAAGATGG - Intronic
1061149599 9:128821265-128821287 TCGGACCTGCAGAGGGAAGGTGG - Exonic
1187039699 X:15580584-15580606 CCTGACCTGCATACTGAAGTCGG - Intronic
1192613679 X:72594449-72594471 TCTGACCTTCAGAAAGAAAAAGG + Intronic
1193669635 X:84368646-84368668 ACTGAACTGTAGATTGAAAAGGG - Intronic
1200007347 X:153096282-153096304 CCTTTCCTGAAGATTGAAGATGG + Intergenic
1201606616 Y:15792706-15792728 TCTGAGCTTCAGAATTAAGATGG - Intergenic