ID: 937149694

View in Genome Browser
Species Human (GRCh38)
Location 2:119678109-119678131
Sequence GGGTGAAAACAGACTGCCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 156}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937149694_937149697 -8 Left 937149694 2:119678109-119678131 CCCTAGGCAGTCTGTTTTCACCC 0: 1
1: 0
2: 2
3: 11
4: 156
Right 937149697 2:119678124-119678146 TTTCACCCTCTGTAAAGGATTGG 0: 1
1: 0
2: 2
3: 18
4: 176
937149694_937149701 -2 Left 937149694 2:119678109-119678131 CCCTAGGCAGTCTGTTTTCACCC 0: 1
1: 0
2: 2
3: 11
4: 156
Right 937149701 2:119678130-119678152 CCTCTGTAAAGGATTGGGCATGG 0: 1
1: 0
2: 2
3: 11
4: 161
937149694_937149698 -7 Left 937149694 2:119678109-119678131 CCCTAGGCAGTCTGTTTTCACCC 0: 1
1: 0
2: 2
3: 11
4: 156
Right 937149698 2:119678125-119678147 TTCACCCTCTGTAAAGGATTGGG 0: 1
1: 0
2: 0
3: 3
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937149694 Original CRISPR GGGTGAAAACAGACTGCCTA GGG (reversed) Intergenic
901093689 1:6661429-6661451 GGGTGAAAACAGCCCTCCGACGG + Intronic
902079576 1:13811977-13811999 GGGTGAACACAGAGTGCGTGAGG + Intronic
903628531 1:24748377-24748399 GAGTGAAAACAAACTGCCTAGGG - Intronic
904734208 1:32617895-32617917 GGAAGAAAACCCACTGCCTAAGG - Intronic
906814709 1:48867008-48867030 GGGAGAAAATAAACTGCCTGTGG + Intronic
907798535 1:57741619-57741641 GAGTGAAAGCAGACTGCTTCTGG + Intronic
914986905 1:152467513-152467535 GGGTAACAACAGACTGGGTATGG - Intergenic
916208806 1:162341699-162341721 GAGTAAGAGCAGACTGCCTATGG - Intronic
917767469 1:178237416-178237438 GGGTGAAATCACACAGGCTAGGG + Intronic
920028968 1:203024641-203024663 GAGTGATAACAGACAACCTAAGG + Exonic
921045692 1:211476423-211476445 GGGTGCAAACAGGCTGGCTGTGG + Intergenic
1063110884 10:3036275-3036297 AGATGAAAACAAACCGCCTACGG - Intergenic
1063683995 10:8218659-8218681 TGGTTAAAACAGGTTGCCTAAGG + Intergenic
1064506211 10:16033446-16033468 GAGAGAAGACAGACTGGCTAGGG + Intergenic
1065591235 10:27264189-27264211 GGTAGAAAATAGAATGCCTAAGG - Intergenic
1065659787 10:27993913-27993935 GGTAGAAAATAGAATGCCTAAGG + Intronic
1067130700 10:43562626-43562648 AGGTGAAAACTGAGTGCCTTTGG + Intronic
1070313295 10:75289022-75289044 AGGTGTAGACAGACTGCCTCAGG + Intergenic
1070460991 10:76670044-76670066 GGGAGAAGAGGGACTGCCTAGGG - Intergenic
1070641275 10:78172032-78172054 GGGAGAAGACAGTGTGCCTAAGG + Intergenic
1071047845 10:81405045-81405067 GTGTGAGGACAGACTGGCTAAGG - Intergenic
1078646029 11:13142070-13142092 TGGTGAAGATAGACTTCCTAAGG + Intergenic
1080651538 11:34226451-34226473 GGGTCAGTACAAACTGCCTAAGG + Intronic
1081001551 11:37679770-37679792 GAGTGAAAACAGATTGCTTCTGG - Intergenic
1083972532 11:66089075-66089097 GAGTGAAAACATTCTGCCCAGGG - Intronic
1085225178 11:74913590-74913612 AGGTGAAAGCAGACTGCTTTTGG - Intronic
1086192406 11:84095116-84095138 GGGTGAAAGGAGACTGCAGAAGG + Intronic
1086394231 11:86397636-86397658 GATGGAAAACAAACTGCCTATGG + Exonic
1088089324 11:106019827-106019849 TTGTGAATACAGACTACCTAAGG + Intronic
1090119091 11:124005601-124005623 GGGTGATGACAGAGTGCCTGGGG + Intergenic
1090178250 11:124671092-124671114 TGGTGAAAACAGACAGACTTGGG - Intronic
1090688470 11:129151771-129151793 GAGTGAAAACAGACTATCTAAGG + Intronic
1091614703 12:2041216-2041238 GGGTTGAAAAAGACTGCTTAGGG + Intronic
1092307666 12:7318094-7318116 GGAAGAAAACACACTGCCAATGG - Exonic
1092770586 12:11892839-11892861 GGGTGCAAACAGATGGACTATGG + Exonic
1094094760 12:26691043-26691065 GAGTGAAAGCAGAATGCTTAAGG - Intronic
1094540090 12:31356224-31356246 GGAGGACAACTGACTGCCTAAGG + Intergenic
1100799505 12:98216467-98216489 GGGTGAAAGCAGAATGAGTAAGG - Intergenic
1101778115 12:107812204-107812226 GGGTGAAAAAAATCTGCCTATGG - Intergenic
1102302031 12:111778061-111778083 GGGTGGAAACAGAGTGCCCCAGG - Intronic
1104225179 12:126824677-126824699 GGGAGTAAACAGACAACCTATGG - Intergenic
1104652640 12:130547414-130547436 GTGAGAAAACAGGCTGCCTTCGG - Intronic
1108642699 13:52397364-52397386 GGCTGAAAACAGCCTGCCCCTGG - Exonic
1109496349 13:63177739-63177761 GGGTGAAAAAAAATTGCATAAGG + Intergenic
1118367362 14:65107577-65107599 GGGTGAGAACAGATTCCCAATGG - Intergenic
1119683570 14:76611867-76611889 AGGTGAAGTCAGGCTGCCTAGGG + Intergenic
1120732192 14:88016325-88016347 GGGTGAAATCAGGCTGCATCTGG - Intergenic
1121195562 14:92068545-92068567 GAGAGAAGACAGACTGGCTAGGG - Intronic
1121861453 14:97322627-97322649 GGGTGAAAAGAGACTTGCTTAGG - Intergenic
1124151803 15:27186865-27186887 GGGAGTAAACAGACAACCTATGG - Intronic
1127513505 15:59667942-59667964 GGGTGAACCCAGAGTTCCTAAGG - Intronic
1128296518 15:66525392-66525414 GGTTGAACACAGACAGACTATGG - Intronic
1128929942 15:71695238-71695260 AGGTTAAACCAGAATGCCTAGGG - Intronic
1134228575 16:12411452-12411474 AGGTGAAAACAGAAAGCCAAAGG + Intronic
1134275662 16:12773927-12773949 GGGAGAAAACAGTGTGCCCAGGG + Intronic
1135100542 16:19601339-19601361 AGGTGAAAACAGGCAGCCCACGG - Intronic
1137535267 16:49316958-49316980 GGGTTAAAACTGGCTGCCTTTGG - Intergenic
1140297728 16:73725594-73725616 GGGTGGATGCAGACTGCTTAGGG + Intergenic
1143962985 17:10735938-10735960 GGCTGAGAACAGACTGCAGAAGG + Intergenic
1144444623 17:15315404-15315426 GGCTGAGAACAGACTGCCGGGGG + Intronic
1144672631 17:17141566-17141588 GAGGGAAAACTGGCTGCCTAAGG - Intronic
1146099740 17:29969038-29969060 GGCTGAAAAAAAACTCCCTAGGG + Exonic
1149207179 17:54261803-54261825 AGATCAAAAGAGACTGCCTAAGG + Intergenic
1151271468 17:72999672-72999694 TGGTGAACACTGACTGCCTAGGG + Intronic
1152828830 17:82484733-82484755 GAGTGAAACCAGACTTCCTGAGG - Intronic
1155567692 18:27154381-27154403 GGGTGGAGACAGACTGCAGAGGG + Intronic
1157093041 18:44659051-44659073 GTGTGAGAACAGCCTGCTTAAGG - Intergenic
1158690755 18:59658064-59658086 AGGTGAATACACCCTGCCTAAGG - Intronic
1159428865 18:68325131-68325153 GGGAGAAAACAGATGGGCTAGGG + Intergenic
1160344966 18:78124807-78124829 GGGTGAAGACAGGCTCCCTGCGG - Intergenic
1163640064 19:18457098-18457120 GAGTGAAAGCAGAGTGCCAAGGG + Intronic
1165967989 19:39600578-39600600 GAGAGTAAACAGACAGCCTAAGG + Intergenic
1166854524 19:45776951-45776973 CGGTGAAGAGAGACGGCCTAAGG + Intronic
1167483637 19:49747530-49747552 GGATGGAAACAGACAGGCTAAGG - Intronic
926295852 2:11567941-11567963 GGATGAGAACAGACTGCCAAAGG - Intronic
928267733 2:29825916-29825938 GGGTTAGAACAGAGTGACTATGG + Intronic
928607656 2:32958459-32958481 GAGTGAAATCAGAGTGCTTAGGG - Intronic
931989033 2:67770935-67770957 GGGTCAATACAGAAGGCCTATGG + Intergenic
932461294 2:71883547-71883569 AGGTGAAAACAGAGGGCATAAGG + Intergenic
932797993 2:74714679-74714701 GCGTGAAAAAAGACTTGCTATGG + Intergenic
933976757 2:87518335-87518357 GGGGCAAAACAGCCTGCCTTGGG + Intergenic
935603705 2:104948300-104948322 AGGTGCAAACAGACTGCCACGGG + Intergenic
935763344 2:106341887-106341909 GGGTGAAATCAGAAAGCCTGGGG + Intergenic
936317058 2:111432469-111432491 GGGGCAAAACAGCCTGCCTTGGG - Intergenic
937093596 2:119222607-119222629 GGGGGAAAGCAAACTGCCTGCGG + Intergenic
937149694 2:119678109-119678131 GGGTGAAAACAGACTGCCTAGGG - Intergenic
941308787 2:163904392-163904414 AGGTGAAAAATGAATGCCTAAGG - Intergenic
944447499 2:199806102-199806124 GGTTGAACTCAGACTGCCTTTGG - Intronic
945655009 2:212612371-212612393 GGGTCAAAAAAGAATTCCTAAGG - Intergenic
946234742 2:218317014-218317036 GGAAGAAAACAAACTGCCTGAGG + Intronic
946989620 2:225313738-225313760 TGGTGTAATCAGACAGCCTAAGG - Intergenic
947582661 2:231331198-231331220 AGATGAAAGCAGACTGCCTAGGG - Intronic
1171405415 20:24909487-24909509 GGGTGAACACTGCCTGCCTATGG - Intergenic
1172272014 20:33660102-33660124 GGGTGAAATGAGACTGGCTTTGG - Intronic
949695986 3:6696221-6696243 GGCTGAAAGAAGAGTGCCTAAGG + Intergenic
951493776 3:23302170-23302192 TGTTGAAAACAGACTGGATATGG - Intronic
954030851 3:47818857-47818879 GGGTGTGAACAGGCAGCCTATGG - Intronic
954111709 3:48437266-48437288 GGGTGACAACAGACTTCATAAGG + Intronic
954684431 3:52362677-52362699 GGGAGAAGTCAGGCTGCCTATGG + Intronic
954698537 3:52440153-52440175 GGGTGGAAACAGACTGGCGGTGG - Intronic
954946849 3:54433638-54433660 GGGAGAAGACAGACGGCCTGCGG + Intronic
956844492 3:73169923-73169945 GGGAGGAAACAGCCTGCCTATGG - Intergenic
960446572 3:117756811-117756833 GAGGGACAGCAGACTGCCTAAGG + Intergenic
961004819 3:123397870-123397892 GGGTGAAAACAGACAGTGAAGGG + Intronic
962250408 3:133832795-133832817 GGTTGCAAACAGACTGCACAGGG - Intronic
962658879 3:137580493-137580515 GGGAGCAAACAGACAGCCTATGG - Intergenic
962960470 3:140306787-140306809 GGGTTGAAACAAACTGCCTTTGG - Intronic
966356982 3:179091043-179091065 GGGAGTAAACAGACAACCTATGG + Intergenic
967097252 3:186187183-186187205 TGGTGAGAACAGGCTACCTAGGG + Intronic
967424208 3:189307491-189307513 GGGTGAAAAAAGCCTGCCTACGG - Intronic
968457744 4:707492-707514 GGGTGAAAACAGGCTGTCCCAGG - Intronic
968494892 4:910111-910133 GGGTGAGACCTGACTGCCTGCGG - Intronic
970321966 4:14883672-14883694 AGATGAAGACAGTCTGCCTATGG - Intergenic
970425550 4:15942653-15942675 TGGTAAAAACACACTGGCTAAGG + Intergenic
971697664 4:29927502-29927524 TGGTAATAACAGACTTCCTAGGG - Intergenic
974637603 4:64584634-64584656 AGGTGACAAGAGAATGCCTATGG - Intergenic
975655417 4:76636650-76636672 GGGGGAAAACAGAGTCCCTGGGG - Intronic
977265128 4:94844719-94844741 TGGTGAAACTAAACTGCCTATGG - Intronic
977750074 4:100599060-100599082 GGGGGAAAACAGGCTTCCTCGGG - Intronic
979916881 4:126446241-126446263 GGGGGAATAGAGACTCCCTATGG - Intergenic
983932572 4:173469062-173469084 GTGTAAACACAGACTGCCTGAGG + Intergenic
986909830 5:12542344-12542366 GGGTGAAAAAAGATTTGCTATGG - Intergenic
987875942 5:23681280-23681302 GGATGAAAAGAGACTGGTTAAGG - Intergenic
989031402 5:37122342-37122364 TTGTGAAAACAGAATTCCTAAGG + Intronic
993009457 5:82463682-82463704 GTGTGTAAACAGACAACCTATGG + Intergenic
994190478 5:96863339-96863361 GGGTGAAACCACACTGCAGAGGG - Intronic
995444564 5:112228416-112228438 GGCTGCAAACAGAGTGCATAAGG - Intronic
995807969 5:116075527-116075549 GTGTGAAAACAGACTGACACAGG + Intergenic
996682080 5:126238571-126238593 GGGTGAAAGTAGAGTGCCTTTGG - Intergenic
1000058297 5:157629021-157629043 GGATGAAAAGAGGCTGACTATGG + Intronic
1001455176 5:171854799-171854821 GGGTCAAAATAGTCTGCCTTTGG - Intergenic
1004190216 6:13457119-13457141 AAGTGAAAACAGACTGCAAAAGG + Intronic
1004615714 6:17286813-17286835 TGGAGAAACCAGACTGTCTAAGG + Intronic
1005233868 6:23736888-23736910 GGGTGAAAACAGTATGCATGAGG - Intergenic
1005860820 6:29898576-29898598 GGGAGAAAATTGAATGCCTATGG - Intergenic
1005869070 6:29959889-29959911 GGGTGAAAATTGAATACCTATGG - Intergenic
1008658239 6:53638452-53638474 GGATGCACACAGACTGCCTTGGG + Intergenic
1009703474 6:67214118-67214140 GGGACAAAACAGAAAGCCTATGG - Intergenic
1015800656 6:137059230-137059252 AGGTGAAACCAGACTACCTCTGG - Intergenic
1015978264 6:138813490-138813512 GGGTGAGAAGAGACTGTCTTTGG - Intronic
1022386488 7:29904147-29904169 TGGTGGAAACAGACAGTCTAGGG + Intronic
1022412826 7:30152549-30152571 AGGAGAAGAGAGACTGCCTAAGG + Intronic
1022937987 7:35200453-35200475 GTTTGAAAACAAACTACCTATGG + Intergenic
1023053335 7:36272371-36272393 GGGTGCAAACACACTCCTTAGGG - Intronic
1024568441 7:50704056-50704078 TGTTGAAAACAGACTGCATAAGG + Intronic
1025927244 7:65970005-65970027 CTGTGAAAACAGACTGGCTGCGG + Intronic
1026143261 7:67724029-67724051 AGGTGCACACAGCCTGCCTAGGG - Intergenic
1026554104 7:71391254-71391276 GGGTGAAGACTCACTGCCAATGG + Intronic
1030327428 7:108235652-108235674 GGGTGGAAACAAATTGCCTCTGG - Intronic
1032761892 7:134951091-134951113 GGGAGAAAACAGGCTTCCTTAGG + Intronic
1033429511 7:141276212-141276234 GGGTGACAGCAGGCTGCCTTGGG + Intronic
1033547672 7:142416317-142416339 GGGTGAAAATAGAATGCAGAGGG - Intergenic
1034485499 7:151358587-151358609 GGGTGAAAACATTCTACCTCAGG - Intronic
1037726277 8:21484993-21485015 GGGTTAAGACAGGCTGCCCAGGG + Intergenic
1040538240 8:48328647-48328669 GGGTGAAAACTGACTCTCCAAGG + Intergenic
1041554827 8:59141819-59141841 GAGTGAACACAGAGTGGCTACGG + Intergenic
1047325524 8:123832164-123832186 GGGATAAACCAGACTGCCCAAGG - Intergenic
1051664708 9:19457788-19457810 GGGTGAAAACTGAATTTCTAAGG - Intergenic
1051698220 9:19791097-19791119 GTCTGAAAGCAGACTGCCCAGGG + Intergenic
1058236381 9:102495484-102495506 GGGTGAAAAATGACTGCTTATGG - Intergenic
1061425541 9:130496086-130496108 GGGCCAAGAGAGACTGCCTAGGG + Intronic
1061939924 9:133878504-133878526 GGGAGACAACACACTGCCCACGG + Intronic
1062553126 9:137099489-137099511 GGGAGAACACAGCCTGCCAAGGG - Intronic
1186530206 X:10287443-10287465 GGGTGACACCAGACTGTCCAGGG + Intergenic
1189470646 X:41311343-41311365 GAGTGAAAGAAGACTGTCTAAGG + Intergenic
1190777917 X:53569005-53569027 AGGTGAGAACACACTCCCTAAGG + Intronic
1191926750 X:66319915-66319937 GGGGGAAAAAAGAATGCCAAAGG + Intergenic
1192161267 X:68789759-68789781 GGGTGGAAACAGACTCAGTAAGG + Intergenic
1194885895 X:99315818-99315840 GTGTGAAAAGATAATGCCTAGGG - Intergenic
1199790074 X:151145301-151145323 GGGAGTAAACAGACCACCTATGG + Intergenic