ID: 937153775

View in Genome Browser
Species Human (GRCh38)
Location 2:119703722-119703744
Sequence AGACACCAGCAGAAGATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937153762_937153775 23 Left 937153762 2:119703676-119703698 CCCGACTCCCTTCCCCTCTGGCT No data
Right 937153775 2:119703722-119703744 AGACACCAGCAGAAGATGGAAGG No data
937153769_937153775 9 Left 937153769 2:119703690-119703712 CCTCTGGCTCCAAGCTGGATTCA No data
Right 937153775 2:119703722-119703744 AGACACCAGCAGAAGATGGAAGG No data
937153767_937153775 11 Left 937153767 2:119703688-119703710 CCCCTCTGGCTCCAAGCTGGATT No data
Right 937153775 2:119703722-119703744 AGACACCAGCAGAAGATGGAAGG No data
937153764_937153775 16 Left 937153764 2:119703683-119703705 CCCTTCCCCTCTGGCTCCAAGCT No data
Right 937153775 2:119703722-119703744 AGACACCAGCAGAAGATGGAAGG No data
937153761_937153775 24 Left 937153761 2:119703675-119703697 CCCCGACTCCCTTCCCCTCTGGC No data
Right 937153775 2:119703722-119703744 AGACACCAGCAGAAGATGGAAGG No data
937153770_937153775 0 Left 937153770 2:119703699-119703721 CCAAGCTGGATTCAGCCCACAGG No data
Right 937153775 2:119703722-119703744 AGACACCAGCAGAAGATGGAAGG No data
937153768_937153775 10 Left 937153768 2:119703689-119703711 CCCTCTGGCTCCAAGCTGGATTC No data
Right 937153775 2:119703722-119703744 AGACACCAGCAGAAGATGGAAGG No data
937153763_937153775 22 Left 937153763 2:119703677-119703699 CCGACTCCCTTCCCCTCTGGCTC No data
Right 937153775 2:119703722-119703744 AGACACCAGCAGAAGATGGAAGG No data
937153765_937153775 15 Left 937153765 2:119703684-119703706 CCTTCCCCTCTGGCTCCAAGCTG No data
Right 937153775 2:119703722-119703744 AGACACCAGCAGAAGATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937153775 Original CRISPR AGACACCAGCAGAAGATGGA AGG Intergenic
No off target data available for this crispr